ZFIN ID: ZDB-TSCRIPT-120213-971
Transcript Name: psmd11a-203
Previous Name: psmd11a-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053629 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053629|OTTDARG00000035062|ZDB-GENE-030131-2711 psmd11a|OTTDARP00000042175 psmd11a-002 LG_ BX890565.9 Danio rerio protein_coding KNOWN, 734 bp
GTTCTTGGATATGGAGGCAGCTACCGGTCAGGAGGTGGAG
CTGTGTTTGGAGTGCATTGAATGGGCCAAATCAGAGAAGA
GGACCTTTCTACGGCAGAGCTGAAGAAGATGGATGATAAA
GCTCTGCTGGTGGAGCTGCAGCTGCTGGAGAGCAAGACAT
ATCATGCCCTGAGCAACTTGCCCAAGGCCAGAGCAGCTCT
CACCTCCGCCAGGACCACCGCAAACGCCATCTACTGCCCC
CCAAAGCTGCAGGCTGCTCTAGACATGCAGTCAGGAATTA
TTCATGCTGCTGAGGAGAAGGACTGGAAGACAGCGTATTC
ATACTTTTACGAGGCGTTTGAAGGCTACGACTCTATTGAC
AGTCCTCGTGCCATCACTGCACTTAAGTACATGCTTCTCT
GCAAGATCATGTTGAACTCGCCAGAGGATGTGCAGTCCCT
GATCAGCGGAAAACTTGCCCTCAGATATGCAGGCAGACAG
ACAGAAGCACTTAAATGTGTGGCACAAGCCAGCAAGAATA
GGTCACTTGCAGATTTTGAGAAGGCTTTAACAGAATACAA
AGCTGAGCTGCGGGACGACCCCATCATCAGCACTCATCTC
ACCAAACTCTATGACAATCTGCTGGAACAAAACCTCATTA
GGGTCATCGAGCCCTTCTCCAGAGTGCAGATTGAACACAT
TTCAGAGCTAATAAAGCTTTCCAAGGGGGATGTTGAAAGA
AAACTCTCACAGAT

psmd11a TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript psmd11a-203 734
mRNA psmd11a-201 (1)    Ensembl 2015
ncRNA psmd11a-003 (1)    Ensembl 832
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
psmd11a-203 Contained in:
[BAC] CH211-250G22 (1)

Genome Resources: Vega_Trans:OTTDART00000053629 (1),  Ensembl_Trans:ENSDART00000151537 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT587110 (1) 734 nt
CITATIONS (2)