Transcript

psmd11a-201

ID
ZDB-TSCRIPT-110325-1521
Name
psmd11a-201
Previous Names
  • psmd11a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000049839 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049839|OTTDARG00000035062|ZDB-GENE-030131-2711 psmd11a|OTTDARP00000039101 psmd11a-001 LG_ BX890565.9 Danio rerio protein_coding KNOWN, 2015 bp
ATCAGGCAATTGGTGAATTGGTAAGATGGCGGCTACGGCG
GTAGAGTTTCAGAGAGCACAGTCGCTGCTCAGTACGGATC
GGAACGCGTCCATTGACATTTTACACGCTATCGTCAAAAG
AGACGTCCAAGATGATGACGAAGAGGCTGTGCGTGTCAAA
GAACAGAGTATTTTGGAGCTGGGCGGACTGTTGGCCAAGA
CCGGACAAGCTGCTGAACTGGGAGGACTGCTGAAGTATGT
CCGGCCGTTCCTGAACTCCATCAGCAAAGCGAAGGCTGCA
CGATTGGTGCGCTCCCTGCTTGATATGTTCTTGGATATGG
AGGCAGCTACCGGTCAGGAGGTGGAGCTGTGTTTGGAGTG
CATTGAATGGGCCAAATCAGAGAAGAGGACCTTTCTACGG
CAGGCCCTGGAGGCCCGACTGGTCTCTCTTTATTTTGACA
CCAAACGTTACCAAGAGGCTCTACAGCTTGGCTCTCAGCT
TCTGCAAGAGCTGAAGAAGATGGATGATAAAGCTCTGCTG
GTGGAGCTGCAGCTGCTGGAGAGCAAGACATATCATGCCC
TGAGCAACTTGCCCAAGGCCAGAGCAGCTCTCACCTCCGC
CAGGACCACCGCAAACGCCATCTACTGCCCCCCAAAGCTG
CAGGCTGCTCTAGACATGCAGTCAGGAATTATTCATGCTG
CTGAGGAGAAGGACTGGAAGACAGCGTATTCATACTTTTA
CGAGGCGTTTGAAGGCTACGACTCTATTGACAGTCCTCGT
GCCATCACTGCACTTAAGTACATGCTTCTCTGCAAGATCA
TGTTGAACTCGCCAGAGGATGTGCAGTCCCTGATCAGCGG
AAAACTTGCCCTCAGATATGCAGGCAGACAGACAGAAGCA
CTTAAATGTGTGGCACAAGCCAGCAAGAATAGGTCACTTG
CAGATTTTGAGAAGGCTTTAACAGAATACAAAGCTGAGCT
GCGGGACGACCCCATCATCAGCACTCATCTCACCAAACTC
TATGACAATCTGCTGGAACAAAACCTCATTAGGGTCATCG
AGCCCTTCTCCAGAGTGCAGATTGAACACATTTCAGAGCT
AATAAAGCTTTCCAAGGGGGATGTTGAAAGAAAACTCTCA
CAGATGATTTTAGACCAGAAATTCCACGGAATCCTTGACC
AAGGGGAAGGTGTCCTGATTGTATTCGACGAGCCACCGGT
AGACAAAACATATGAAGCCTCCCTCGAAACAATTCAGAAC
ATGAGCAAAGTAGTGGACTCGCTCTACAACAAAGCCAAGA
AGTTGACATAGGCAAGCCCTGATTTTACCCTGCAGCTCAG
AGCATGGCCAGTGTGGGGGGACTCTGGGGGAAGGGGAAGG
GAAAATTAAAAAAAAAAAGGTCTAAAACCCCAAACAGACT
GACTCCTGCTGTTGTCCTCTCTGGCTTACACTTGGACATT
TTTTTACCACCTTCTTCAATGGACAAACTACTTCTATTAC
TATGGGATCACATTTCTTTTTTTATTATTTTCACTTTTTT
TTTTTTTGCTGATAATTCATTTCTTTGTATCTTGGCTGTG
CCTAATGGGCCATCAGGGAATCTTCAAAAGAATAAAATAA
AAACTCACCTGCATTATAACTCTATTTGAAATGTATATAC
GTAGATCTCTGGTAGAGCAAAGCTGATATAAGAATGATTC
ACCTCCCTTGCAAATCCGGGGGCTGTTGTGTTGAGTTTGC
CCATACAAGATTCCCCATATTACCAATTCAACGGTTTTAG
GCCTCTCAAAAGGAAGCCCCTGGCCTCGCTCCAGGCCTAC
CTCTCGAACAGACAGCGTTCTTGGACTTTTTATTGTCGAG
CGGAAAGGTTTGAATAAGCTGCTGTCATCAGGATGGGCTT
GTGAGCTGTTGTCATTCCTGCCCTTCCTCCTCCTCCCTCT
TTGTACATAACGTTGCCAAGCGCCTCTGTCTGGCCTGTCA
TGCTGTTGCCCTTTTTTATAACGCTAAAAAAAACATAATA
AAGTCACCAAGAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations