Transcript

psmd11a-003

ID
ZDB-TSCRIPT-120213-585
Name
psmd11a-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000053628 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053628|OTTDARG00000035062|ZDB-GENE-030131-2711 psmd11a|no_translation psmd11a-003 LG_ BX890565.9 Danio rerio protein_coding KNOWN, 832 bp
TTTTGTTTTTTTTTAAGGTAAAACATTTCTGTTTTAGCTG
GGTAAATATACCCTTATTTCAAATTAAATGATCTACCATC
TACCTGCTGAGGATTAAAAATACTTGAATTTTTACTGTAA
CATATCTGTCAGAAATTGGTGTGCTTATTTCTTTTTTATT
TATTTATTTATTTTTTTTAAAGTTTCATCCATTTTTTCCT
TTCTCTTCTCAGGGGGATGTTGAAAGAAAACTCTCACAGA
TGATTTTAGACCAGAAATTCCACGGAATCCTTGACCAAGG
GGAAGGTGTCCTGATTGTATTCGACGAGCCACCGGTAGAC
AAAACATATGAAGCCTCCCTCGAAACAATTCAGAACATGA
GCAAAGTAGTGGACTCGCTCTACAACAAAGCCAAGAAGTT
GACATAGGCAAGCCCTGATTTTACCCTGCAGCTCAGAGCA
TGGCCAGTGTGGGGGGACTCTGGGGGAAGGGGAAGGGAAA
ATTAAAAAAAAAAAGGTCTAAAACCCCAAACAGACTGACT
CCTGCTGTTGTCCTCTCTGGCTTACACTTGGACATTTTTT
TACCACCTTCTTCAATGGACAAACTACTTCTATTACTATG
GGATCACATTTCTTTTTTTATTATTTTCACTTTTTTTTTT
TTTGCTGATAATTCATTTCTTTGTATCTTGGCTGTGCCTA
ATGGGCCATCAGGGAATCTTCAAAAGAATAAAATAAAAAC
TCACCTGCATTATAACTCTATTTGAAATGTATATACGTAG
ATCTCTGGTAGAGCAAAGCTGATATAAGAATGATTCACCT
CCCTTGCAAATCCGGGGGCTGTTGTGTTGAGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations