ZFIN ID: ZDB-TSCRIPT-120213-929
Transcript Name: flr-201
Previous Name: flr-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053456 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053456|OTTDARG00000037452|ZDB-GENE-070117-2066 flr|OTTDARP00000042048 flr-001 LG_ BX510989.13 Danio rerio protein_coding NOVEL, 2559 bp
GCTCTGGGAAGCGTCATGTATTGATTACGTCACTTCCGTT
TCTTGGACGGTTGCTAAGCGACATGATGTCTGCGTCGTTC
CACTGAAAACATTCAGCGCTGCATCTTCAACTTTACAAAA
AAAATACGTTTTTGTTTATGGAGTAAAGCTGCATGAAGCG
TTGGGTTCAATAATGCCGCCAATGACGATTAAAGACGGCG
AATACACGGCCACCGTGTACAAAATGATTAAAGAAGGGCG
ATATGGAGACGCAATTCATATCCTGAGCAAAGAACATCAG
AAACACACTAAATCCAGGGCTGCTTTGTCTCTCCTTGGCT
ACTGTTACTATCACATGCAAGACTTCACTAATGCAGCTGA
GTGTTATGAGCAGTTAACACAGCTTCACCCTGAGGTGGAG
GACTACAAACTTTACTACGCCCAGTCTCTATATGGAGCAT
GTGCCTTTCCAGAGGCCATGAAGTCTACTTTTCTCTTGGA
CAACACAACAAGTCATACCAAGATGATCAAACTGCAGGCT
GCAATCAAATATGGAGAGGAAGATTATTCTGGTGCAAAGA
CACTGGTTGAGCAGTTGCCTCAGGAAGATCCAGACTATGA
TGTGGATCTCGGCTGTTTGCTTTATAAGGAAGGCGAGTTT
GAAGAGGCCTGCAAAAAGTTTATGTCCTCCATGAATGTAC
TAGGCTACCAGCCAGATCTGGCATACAATATAGCGCTTTG
TTACTACAGTTTAAAACAGTATGCCTCAGCGCTCAAATAT
ATTGCTGAAATTATTGAACGTGGAATTAGAGAGCATCCGG
AACTGAGTATTGGAATGACGACAGAAGGCATTGATGTAAG
GAGTGTCGGCAACACCCTCATCCTGCACGAGACTGCTTTG
ATTGAAGCCTTTAATCTGAAAGCAGCTATTGAATACCAGC
TAAAGAACTATGCTGCAGCACAGGAAGCACTGACGGACAT
GCCTCCCAGATCAGAAGAGGAATTGGATCCAGTTACTCTT
CACAATCAGGCCTTAATGAACATGGACACCAAACCTACAG
AGGGCTTTGAGAAGCTTGCTTTCCTCCTTCAGCAAAACCC
CTTCCCTCCTGTTACTTTTGGCAACTTACTTTTGCTTTAC
TGTAAATATGAGTACTTTGACCTTGCAGCAGATGTCTTGG
CTGAAAATGCGCATCTCACATACAAGTTTCTTACACCGTA
TCTTTATGAGTTCCTGGATGCCATGATCACATGCCAAACA
GCTCCTGAGGAAGCGTTTCGAAAATTTGACGAAAATGCTG
GGAAACTGACTGAACAGCTCCGCAAGGTTACGAAACAGGT
GCAAGAAGCAAGGCACAACCGAGATGATGAATCCTTAAAA
AAATACGTCCAAGACTATGACGAAGTCCTTGAGAAGTACA
TCCCTGTACTAATGGCACAGGCCAAAATCTACTGGAACCG
TGAAAACTACAGCATGGTGGAAAAGATCTTTCACAAGTCA
CTGGAGTTCTGCAATGAGCACGACACTTGGAAGCTGAATG
TTGCTCATGTGCTCTTCATGCAAGATAACAAATATAAAGA
AGCCATTGGCTTCTATGAGCCCATTGTTAAAAAGCATTAT
GAGAATATCCTCAACGTCAGTGCAATTGTTCTTGCAAACC
TGTGTGTGTCGTACATCATGACCAGCCAAAATGAAGAGGC
AGAGGAACTGATGAGGAAAATAGAGAAAGAAGAAGAGCAG
ATCTCCTATGATGATCCAGACAAAAAAATCTTTCATTTGT
GCATTGTCAACCTTGTAATAGGGACTTTGTATTGTGCTAA
AGGGAATTATGACTTTGGCATTTCCCGAGTCATAAAGAGC
CTTGAGCCATACAACAAAAAGCTTGGAACAGACACATGGT
TCTACGCTAAGAGATGTTTTCTCTCGCTGCTGGAAAACAT
GGCCAAGCACATGATCATGCTCAGAGATTCAGTAGTGCAA
GAGTGCATTCAGTTCCTTGAGCACTGTGAATTGTACGGCA
AAGATGTGCTTGCCATCATAGAGCAACCTCTGGAGGAGGA
TCGCATGCACATTGGCAAGAACACCGTCACGTATGAATCC
CGCCTGATAAAAGCTCTCTTCTATGAAGTCACAGGATGGA
ATGAGTAACCCTTATACATCACGAATATTCAGAGACACAC
AGCGTGGTTTTCTCACTGAAGCTTTAAAGTCTAAATGATG
TCTTGGATAGATGGCAGTTTGACTAATAAGGTATCTCAGC
TTGGCTACTTTTTAAGCGGCTTTTGGGGAGATCACGCTGT
TTCTGGACTGAATTCAAACATGCATTTTTAAGCATGCATT
CATTGTAATAATGAAGCCACAGGGGTTTGCTCCCTCGAAA
CAGGAAAGCTTAACCCATGAGGAAATATTCGACACAGAAG
GGCATCTATTTTTAATTTAAACTAAGCTCTGTTTGCTCTA
AATATTATAAAACATGTCTATTTAACCTTTTAGGTTCTGT
GCATCACAGTCAATGGCATTAAAACTGTACAGTCTAAATA
TTTTTCTTCAGAATAAAAAAGAAAATAGATGGAAATAAA

flr TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript flr-202 (1)    Ensembl 2015
mRNA flr-201 2559
ncRNA flr-003 (1)    Ensembl 575
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
flr-201 Contained in:
[BAC] CH211-76L23 (1)

Genome Resources: Vega_Trans:OTTDART00000053456 (1),  Ensembl_Trans:ENSDART00000055422 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EF653429 (1) 2404 nt
GenBank:BC163912 (1) 2109 nt
CITATIONS (2)