Transcript

flr-202

ID
ZDB-TSCRIPT-120213-159
Name
flr-202
Previous Names
  • flr-002
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000053457 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053457|OTTDARG00000037452|ZDB-GENE-070117-2066 flr|OTTDARP00000042049 flr-002 LG_ BX510989.13 Danio rerio protein_coding NOVEL, 2015 bp
TCTGCGTCGTTCCACTGAAAACATTCAGCGCTGCATCTTC
AACTTTACAAAAAAAATACGTTTTTGTTTATGGAGTAAAG
CTGCATGAAGCGTTGGGTTCAATAATGCCGCCAATGACGA
TTAAAGACGGCGAATACACGGCCACCGTGTACAAAATGAT
TAAAGAAGGGCGATATGGAGACGCAATTCATATCCTGAGC
AAAGAACATCAGAAACACACTAAATCCAGGGCTGCTTTGT
CTCTCCTTGGCTACTGTTACTATCACATGCAAGACTTCAC
TAATGCAGCTGAGTGTTATGAGCAGTTAACACAGCTTCAC
CCTGAGGTGGAGGACTACAAACTTTACTACGCCCAGTCTC
TATATGGAGCATGTGCCTTTCCAGAGGCCATGAAGTCTAC
TTTTCTCTTGGACAACACAACAAGTCATACCAAGATGATC
AAACTGCAGGCTGCAATCAAATATGGAGAGGAAGATTATT
CTGGTGCAAAGACACTGGTTGAGCAGTTGCCTCAGGAAGA
TCCAGACTATGATGTGGATCTCGGCTGTTTGCTTTATAAG
GAAGGCGAGTTTGAAGAGGCCTGCAAAAAGTTTATGTCCT
CCATGAATGTACTAGGCTACCAGCCAGATCTGGCATACAA
TATAGCGCTTTGTTACTACAGTTTAAAACAGTATGCCTCA
GCGCTCAAATATATTGCTGAAATTATTGAACGTGGAATTA
GAGAGCATCCGGAACTGAGTATTGGAATGACGACAGAAGG
CATTGATGTAAGGAGTGTCGGCAACACCCTCATCCTGCAC
GAGACTGCTTTGATTGAAGCCTTTAATCTGAAAGCAGCTA
TTGAATACCAGCTAAAGAACTATGCTGCAGCACAGGAAGC
ACTGACGGACATGCCTCCCAGATCAGAAGAGGAATTGGAT
CCAGTTACTCTTCACAATCAGGCCTTAATGAACATGGACA
CCAAACCTACAGAGGGCTTTGAGAAGCTTGCTTTCCTCCT
TCAGCAAAACCCCTTCCCTCCTGTTACTTTTGGCAACTTA
CTTTTGCTTTACTGTAAATATGAGTACTTTGACCTTGCAG
CAGATGTCTTGGCTGAAAATGCGCATCTCACATACAAGTT
TCTTACACCGTATCTTTATGAGTTCCTGGATGCCATGATC
ACATGCCAAACAGCTCCTGAGGAAGCGTTTCGAAAATTTG
ACGAAAATGCTGGGAAACTGACTGAACAGCTCCGCAAGGT
GCAAGAAGCAAGGCACAACCGAGATGATGAATCCTTAAAA
AAATACGTCCAAGACTATGACGAAGTCCTTGAGAAGTACA
TCCCTGTACTAATGGCACAGGCCAAAATCTACTGGAACCG
TGAAAACTACAGCATGGTGGAAAAGATCTTTCACAAGTCA
CTGGAGTTCTGCAATGAGCACGACACTTGGAAGCTGAATG
TTGCTCATGTGCTCTTCATGCAAGATAACAAATATAAAGA
AGCCATTGGCTTCTATGAGCCCATTGTTAAAAAGCATTAT
GAGAATATCCTCAACGTCAGTGCAATTGTTCTTGCAAACC
TGTGTGTGTCGTACATCATGACCAGCCAAAATGAAGAGGC
AGAGGAACTGATGAGGAAAATAGAGAAAGAAGAAGAGCAG
ATCTCCTATGATGATCCAGACAAAAAAATCTTTCATTTGT
GCATTGTCAACCTTGTAATAGGCTTGGAACAGACACATGG
TTCTACGCTAAGAGATGTTTTCTCTCGCTGCTGGAAAACA
TGGCCAAGCACATGATCATGCTCAGAGATTCAGTAGTGCA
AGAGTGCATTCAGTTCCTTGAGCACTGTGAATTGTACGGC
AAAGATGTGCTTGCCATCATAGAGCAACCTCTGGAGGAGG
ATCGCATGCACATTGGCAAGAACACCGTCACGTATGAATC
CCGCCTGATAAAAGCTCTCTTCTATGAAGTCACAGGATGG
AATGAGTAACCCTTATACATCACGAATATTCAGAGACACA
CAGCGTGGTTTTCTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations