ZFIN ID: ZDB-TSCRIPT-120213-89
Transcript Name: cyt1l-203
Previous Name: cyt1l-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053196 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053196|OTTDARG00000014146|ZDB-GENE-061026-4 cyt1l|OTTDARP00000041847 cyt1l-003 LG_ BX323079.7 Danio rerio protein_coding KNOWN, 790 bp
ACTCATCCGCTCACTTCCTTCTCCAGGTAGAGCAGACGAC
GACAGCAAGACTCCTTCAAAATGATGTCTTCTTCATCCAT
CCGCATGTCCTCAGGAGGATCTTCCCGCCTCTCTGTCGGT
GGTGGAGCCGGTCGTGTCTCAGGAGTGCGTGCTGGTAGTG
TCTATGGAGGAGCAGGAGGATCCGGTGTTCGCATCTCCAG
TTCTTCTGCTTCCAGATCCTTCTCTGCTGGTGGCGGCGCA
GGATTTGGTGGTGGTGCTGGTGCGCAGCCTGGAGAAGGCC
AATGCAGATCTTGAGCTGAAGATCCGCCAGTTCCTGGACA
GCAAGGCCACGCCTAATGCTCGTGACTACAGTGCCTACTA
TGCAACAATCAGTGACCTCCAGGCAAAGATCCTGCATGCT
ACTGGTGTAAATGGAGGCATCTACCTCAGCATTGACAATG
CCAAGCTGGCTGCAGATGACTTCAGAGTCAAGTATGAGAA
TGAGCTGACCATGAGGCAGTCTGTGGAAGCAGACATTGTT
GGCTTGAGGAAGGTGCTGGATGAGCTCACAATGACCAGAT
CTGACCTGGAGTTGCAGATCGAGGGTCTGAAAGAAGAACT
GATCTTCCTCAAGAAGAACCACGAGGAGGAGCTCTTGGCA
GCACGCACCCAGATGAGTGGACAAGTCAATGTAGAGGTCG
ATGCAGCACCACAGGAAGACCTGACAAAGATCATGGCTGA
TATCCGTGAGCACTATGAGGCAGTTTCTGCCAAGAACCGT
AAAGATCTTGAGAGTTGGTTCCAGGCCAAG

cyt1l TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA cyt1l-002 (1) 850
mRNA cyt1l-202 (1) 1419
aberrant processed transcript cyt1l-203 790
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyt1l-203 Contained in:
[BAC] DKEYP-113D7 (1)
OTHER cyt1l-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053196 (1)
  • Ensembl_Trans:ENSDART00000142096 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DT865715 (1) 780bp
    GenBank:CB357729 (1) 500bp
    CITATIONS (2)