Transcript

cyt1l-202

ID
ZDB-TSCRIPT-090929-3566
Name
cyt1l-202
Previous Names
  • cyt1l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000016878 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000016878|OTTDARG00000014146|ZDB-GENE-061026-4 cyt1l|OTTDARP00000014307 cyt1l-001 LG_ BX323079.7 Danio rerio protein_coding KNOWN, 1419 bp
ACTCATCCGCTCACTTCCTTCTCCAGGTAGAGCAGACGAC
GACAGCAAGACTCCTTCAAAATGATGTCTTCTTCATCCAT
CCGCATGTCCTCAGGAGGATCTTCCCGCCTCTCTGTCGGT
GGTGGAGCCGGTCGTGTCTCAGGAGTGCGTGCTGGTAGTG
TCTATGGAGGAGCAGGAGGATCCGGTGTTCGCATCTCCAG
TTCTTCTGCTTCCAGATCCTTCTCTGCTGGTGGCGGCGCA
GGATTTGGTGGTGGTGCTGGTGCTGGCTTCAACCTGTCTG
ATGCCATTGACGTGTCAACAAATGAGAAAGCCACCATGCA
AAACCTCAATGACCGTCTGGCCTCCTACCTGGAGAAGGTG
CGCAGCCTGGAGAAGGCCAATGCAGATCTTGAGCTGAAGA
TCCGCCAGTTCCTGGACAGCAAGGCCACGCCTAATGCTCG
TGACTACAGTGCCTACTATGCAACAATCAGTGACCTCCAG
GCAAAGATCCTGCATGCTACTGGTGTAAATGGAGGCATCT
ACCTCAGCATTGACAATGCCAAGCTGGCTGCAGATGACTT
CAGAGTCAAGTATGAGAATGAGCTGACCATGAGGCAGTCT
GTGGAAGCAGACATTGTTGGCTTGAGGAAGGTGCTGGATG
AGCTCACAATGACCAGATCTGACCTGGAGTTGCAGATCGA
GGGTCTGAAAGAAGAACTGATCTTCCTCAAGAAGAACCAC
GAGGAGGAGCTCTTGGCAGCACGCACCCAGATGAGTGGAC
AAGTCAATGTAGAGGTCGATGCAGCACCACAGGAAGACCT
GACAAAGATCATGGCTGATATCCGTGAGCACTATGAGGCA
GTTTCTGCCAAGAACCGTAAAGATCTTGAGAGTTGGTTCC
AGGCCAAGAGTGAGTCCCTCAACAAGGAAGTTGCTGTGAG
CACAGAAACTCTCCAAACATCCCGCTCTGAAATCACAGAG
GTTAAGCGCACACTCCAGAGTCTTGAAATCGAACTACAGT
CACAACTCAGCATGAAAGCGTCATTGGAAGGCACTCTGGC
AGACACACAGGCCCGCTACACCAACATGTTGAATGGTTAC
CAGTTCCAGGTGAGCAGCCTGGAAGAGCAACTGATACAGC
TCCGTGCTGATCTGGAGCGCCAAGGTCAAGAGTACCAGAT
GCTTCTGGACATCAAGACCAGACTGGAGATGGAGATTGCA
GAGTACAGAAGACTGCTGGATGGAGAGGCTACTAGTGTTT
CCACAAGCTCAAGCACTACACGCAAAGTAGTAACCATTGT
GGAAGAGGTGGTGGATGGAAAAGTGGTCAGCTCATCCTCC
AAGGCCACAACCGAGACTAAAACCACTTAAGAGAAATCTT
CAGCAAAATAGTTCTCAATCAGTGTGATAAGAAAACCAAT
AAACTGGTCTCACTGTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations