header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-3566
Transcript Name: cyt1l-202
Previous Name: cyt1l-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000016878 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000016878|OTTDARG00000014146|ZDB-GENE-061026-4 cyt1l|OTTDARP00000014307 cyt1l-001 LG_ BX323079.7 Danio rerio protein_coding KNOWN, 1419 bp
ACTCATCCGCTCACTTCCTTCTCCAGGTAGAGCAGACGAC
GACAGCAAGACTCCTTCAAAATGATGTCTTCTTCATCCAT
CCGCATGTCCTCAGGAGGATCTTCCCGCCTCTCTGTCGGT
GGTGGAGCCGGTCGTGTCTCAGGAGTGCGTGCTGGTAGTG
TCTATGGAGGAGCAGGAGGATCCGGTGTTCGCATCTCCAG
TTCTTCTGCTTCCAGATCCTTCTCTGCTGGTGGCGGCGCA
GGATTTGGTGGTGGTGCTGGTGCTGGCTTCAACCTGTCTG
ATGCCATTGACGTGTCAACAAATGAGAAAGCCACCATGCA
AAACCTCAATGACCGTCTGGCCTCCTACCTGGAGAAGGTG
CGCAGCCTGGAGAAGGCCAATGCAGATCTTGAGCTGAAGA
TCCGCCAGTTCCTGGACAGCAAGGCCACGCCTAATGCTCG
TGACTACAGTGCCTACTATGCAACAATCAGTGACCTCCAG
GCAAAGATCCTGCATGCTACTGGTGTAAATGGAGGCATCT
ACCTCAGCATTGACAATGCCAAGCTGGCTGCAGATGACTT
CAGAGTCAAGTATGAGAATGAGCTGACCATGAGGCAGTCT
GTGGAAGCAGACATTGTTGGCTTGAGGAAGGTGCTGGATG
AGCTCACAATGACCAGATCTGACCTGGAGTTGCAGATCGA
GGGTCTGAAAGAAGAACTGATCTTCCTCAAGAAGAACCAC
GAGGAGGAGCTCTTGGCAGCACGCACCCAGATGAGTGGAC
AAGTCAATGTAGAGGTCGATGCAGCACCACAGGAAGACCT
GACAAAGATCATGGCTGATATCCGTGAGCACTATGAGGCA
GTTTCTGCCAAGAACCGTAAAGATCTTGAGAGTTGGTTCC
AGGCCAAGAGTGAGTCCCTCAACAAGGAAGTTGCTGTGAG
CACAGAAACTCTCCAAACATCCCGCTCTGAAATCACAGAG
GTTAAGCGCACACTCCAGAGTCTTGAAATCGAACTACAGT
CACAACTCAGCATGAAAGCGTCATTGGAAGGCACTCTGGC
AGACACACAGGCCCGCTACACCAACATGTTGAATGGTTAC
CAGTTCCAGGTGAGCAGCCTGGAAGAGCAACTGATACAGC
TCCGTGCTGATCTGGAGCGCCAAGGTCAAGAGTACCAGAT
GCTTCTGGACATCAAGACCAGACTGGAGATGGAGATTGCA
GAGTACAGAAGACTGCTGGATGGAGAGGCTACTAGTGTTT
CCACAAGCTCAAGCACTACACGCAAAGTAGTAACCATTGT
GGAAGAGGTGGTGGATGGAAAAGTGGTCAGCTCATCCTCC
AAGGCCACAACCGAGACTAAAACCACTTAAGAGAAATCTT
CAGCAAAATAGTTCTCAATCAGTGTGATAAGAAAACCAAT
AAACTGGTCTCACTGTGAA

cyt1l TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA cyt1l-002 (1) 850
mRNA cyt1l-202 1419
aberrant processed transcript cyt1l-203 (1) 790
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyt1l-202 Contained in:
[BAC] DKEYP-113D7 (1)
OTHER cyt1l-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000016878 (1)
  • Ensembl_Trans:ENSDART00000105036 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC163021 (1) 1364bp
    GenBank:CO960775 (1) 832bp
    GenBank:CK667486 (1) 761bp
    GenBank:EB858928 (1) 678bp
    CITATIONS (2)