header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-120213-474
Transcript Name: cyt1l-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053197 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053197|OTTDARG00000014146|ZDB-GENE-061026-4 cyt1l|no_translation cyt1l-002 LG_ BX323079.7 Danio rerio protein_coding KNOWN, 850 bp
CGTCTTCTCCTCACTCATCCGCTCACTTCCTTCTCCAGGT
AGAGCAGACGACGACAGCAAGACTCCTTCAAAATGATGTC
TTCTTCATCCATCCGCATGTCCTCAGGAGGATCTTCCCGC
CTCTCTGTCGGTGGTGGAGCCGGTCGTGTCTCAGGAGTGC
GTGCTGGTAGTGTCTATGGAGGAGCAGGAGGATCCGGTGT
TCGCATCTCCAGTTCTTCTGCTTCCAGATCCTTCTCTGCT
GGTGGCGGCGCAGGATTTGGTGGTGGTGCTGGTGCTGGCT
TCAACCTGTCTGATGCCATTGACGTGTCAACAAATGAGAA
AGCCACCATGCAAAACCTCAATGACCGTCTGGCCTCCTAC
CTGGAGAAGGTGCGCAGCCTGGAGAAGGCCAATGCAGATC
TTGAGCTGAAGATCCGCCAGTTCCTGGACAGCAAGGCCAC
GCCTAATGCTCGTGACTACAGTGCCTACTATGCAACAATC
AGTGACCTCCAGGCAAAGGTATGTGACAACTTTTGAATGT
GTGATTAATTTAATCATTGCATTTCCAAATGAACAAATTC
CAAATATCTTTTTATGAAGGTTTGATGCTTCATATTATTT
AAGAAAATCATTGCATTTGTCCTTAAAGATCCTGCATGCT
ACTGGTGTAAATGGAGGCATCTACCTCAGCATTGACAATG
CCAAGCTGGCTGCAGATGACTTCAGAGTCAAGTATGAGAA
TGAGCTGACCATGAGGCAGTCTGTGGAAGCAGACATTGTT
GGCTTGAGGAAGGTGCTGGATGAGCTCACAATGACCAGAT
CTGACCTGGAGTTGCAGATCGAGGGTCTGAAAGAAGAACT
GATCTTCCTC

cyt1l TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA cyt1l-002 850
mRNA cyt1l-202 (1) 1419
aberrant processed transcript cyt1l-203 (1) 790
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyt1l-002 Contained in:
[BAC] DKEYP-113D7 (1)
OTHER cyt1l-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053197 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT671220 (1) 852bp
    CITATIONS (1)