Transcript

cyt1l-002

ID
ZDB-TSCRIPT-120213-474
Name
cyt1l-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053197 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053197|OTTDARG00000014146|ZDB-GENE-061026-4 cyt1l|no_translation cyt1l-002 LG_ BX323079.7 Danio rerio protein_coding KNOWN, 850 bp
CGTCTTCTCCTCACTCATCCGCTCACTTCCTTCTCCAGGT
AGAGCAGACGACGACAGCAAGACTCCTTCAAAATGATGTC
TTCTTCATCCATCCGCATGTCCTCAGGAGGATCTTCCCGC
CTCTCTGTCGGTGGTGGAGCCGGTCGTGTCTCAGGAGTGC
GTGCTGGTAGTGTCTATGGAGGAGCAGGAGGATCCGGTGT
TCGCATCTCCAGTTCTTCTGCTTCCAGATCCTTCTCTGCT
GGTGGCGGCGCAGGATTTGGTGGTGGTGCTGGTGCTGGCT
TCAACCTGTCTGATGCCATTGACGTGTCAACAAATGAGAA
AGCCACCATGCAAAACCTCAATGACCGTCTGGCCTCCTAC
CTGGAGAAGGTGCGCAGCCTGGAGAAGGCCAATGCAGATC
TTGAGCTGAAGATCCGCCAGTTCCTGGACAGCAAGGCCAC
GCCTAATGCTCGTGACTACAGTGCCTACTATGCAACAATC
AGTGACCTCCAGGCAAAGGTATGTGACAACTTTTGAATGT
GTGATTAATTTAATCATTGCATTTCCAAATGAACAAATTC
CAAATATCTTTTTATGAAGGTTTGATGCTTCATATTATTT
AAGAAAATCATTGCATTTGTCCTTAAAGATCCTGCATGCT
ACTGGTGTAAATGGAGGCATCTACCTCAGCATTGACAATG
CCAAGCTGGCTGCAGATGACTTCAGAGTCAAGTATGAGAA
TGAGCTGACCATGAGGCAGTCTGTGGAAGCAGACATTGTT
GGCTTGAGGAAGGTGCTGGATGAGCTCACAATGACCAGAT
CTGACCTGGAGTTGCAGATCGAGGGTCTGAAAGAAGAACT
GATCTTCCTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations