ZFIN ID: ZDB-TSCRIPT-120213-1109
Transcript Name: sox4a-203
Previous Names: dkey-150k17.4-001, ottdart00000054531

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054531 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054531|OTTDARG00000038076|ZDB-GENE-030131-8290 sox4a|OTTDARP00000042835 DKEY-150K17.4-001 LG_ BX957317.12 Danio rerio protein_coding PUTATIVE, 597 bp
GCTGACCTCACACTCCGTCCCTGCAGACCACCACGCACTC
TACAAATCCAGGTCCGTGTCCGCCGCCAAACAAATCCCAG
AGAAACCAGCAAAGCGCGGGCATGTGTACGGGGGATGCAG
CACAGACAGCAGCCCGCCCTCTGTCGCGGTGCCGGCCAGT
CCCACCCTGAGCAGCTCGGCGGAATCCAGCGACCCGCTGA
GCTTGTACGAGGACGGGCTCGCGAGCGGAAAGGAAGACGC
GGAGCCTGCCGCGCGCTTCAAGTACACCCGCGCGCCGTCT
CCGACGCCCTCCGCCTCGCACTCGTACTCCTCGCAGTCAT
CCTCCTCGGATGAGGAGTTCGAGGACGAGCTGGCGGACCC
CAGCCCTGGCTTTGACAGCTTCAGCACCTTTGGCACAGCG
CCTCTGGACAGAGATTTGGAGTTCAACTTTGAGTCGGGCT
CCGGCTCGCACTTTGAGTTCCCCGACTACTGCACACCAGA
GGTTCTTGTGTGGGAGCTGAGGTCTTTTCCCAGACACAAC
AGAAGCCAGAGCCTGTGGTTGATTTCATGACTTCCTCCTC
ATTGTTTGCCTGTCTGCGTGACTGGAAACCGGCAGTG

sox4a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA sox4a-201 (1) 3261
sox4a-203 597
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sox4a-203 Contained in:
OTHER sox4a-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000054531 (1)
  • Ensembl_Trans:ENSDART00000151793 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CD279806 (1) 597bp
    CITATIONS (2)