header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-3977
Transcript Name: sox4a-201
Previous Name: sox4a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000017993 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000017993|OTTDARG00000015033|ZDB-GENE-030131-8290 sox4a|OTTDARP00000015199 sox4a-001 LG_ BX957317.12 Danio rerio protein_coding KNOWN, 3261 bp
TCGGAAGCTCAGAGCATGAAAAAGTGCAGTCGTCTAAACC
TACCGCATGGTCATACGACAAACTATGCTGAAGACACTTG
TCCGTTTCCATTAAACGGCTTCAGATACTTTGCGTCCAGA
GCGCACTCTGGGTTCGTTTTCAGTCGAACCGGCAGTTGAA
CGACAGACTGTTGATTTTGACGAGATTGCCAGGATTGACA
GAGCTCCTGACTGGGATATGCGCTTTGCGGATGGCGCGCT
GAACCAAAAGACAGCAGAAGCAGCAACTTTGTTTCCACAT
TGACCAAAGCATATTTTATACAAGAGTGAAGAAGAAAGAC
TCTTAGCGCTTTCAACGCGTCTAGCGCTGCAGCACGTGTA
GGATTTTTGTGCGCAATTAAAAGTTGAGACTGTTGTAGTG
CATGGGCACAGACCTGGCTATGGTGGAGCAGACGCACACC
AGCAGCAGCAGCAGTAGCGACGTGCTCCCCGGCGACTCCA
TTGATTCTGGGGAGATGGACTTAGACATGGACGCCTCTCC
GACTCCAGGCTCTCCAAATTCAGCCGGTGATAAAATGGAC
ATTGCCTGGTGCAAAACCCCATCGGGACACATCAAGAGGC
CAATGAACGCATTCATGGTCTGGTCGCAGATTGAGAGGCG
CAAGATTATGGAGCAGTCGCCGGACATGCACAACGCGGAG
ATCTCCAAGAGACTCGGCAAGCGCTGGAAACTTTTAAAAG
ACAGCGACAAGATCCCCTTCATCCGCGAGGCCGAGCGCCT
GCGGCTCAAGCACATGGCAGACTATCCAGACTACAAATAT
CGACCTCGGAAGAAGGTGAAGTCATCCAGCGGAAAGACTG
GAGAGAAGGCGGAGCGCGTGAGCGCTAGCCCCGGCGCCAA
GTCTGCATCCAAAAAGAGCTCGAAAACTCTCAGCAGGACG
CACAGAAAGTCCACAACGCTCGAGCTGACCTCACACTCCG
TCCCTGCAGACCACCACGCACTCTACAAATCCAGGTCCGT
GTCCGCCGCCAAACAAATCCCAGAGAAACCAGCAAAGCGC
GGGCATGTGTACGGGGGATGCAGCACAGACAGCAGCCCGC
CCTCTGTCGCGGTGCCGGCCAGTCCCACCCTGAGCAGCTC
GGCGGAATCCAGCGACCCGCTGAGCTTGTACGAGGACGGG
CTCGCGAGCGGAAAGGAAGACGCGGAGCCTGCCGCGCGCT
TCAAGTACACCCGCGCGCCGTCTCCGACGCCCTCCGCCTC
GCACTCGTACTCCTCGCAGTCATCCTCCTCGGATGAGGAG
TTCGAGGACGAGCTGGCGGACCCCAGCCCTGGCTTTGACA
GCTTCAGCACCTTTGGCACAGCGCCTCTGGACAGAGATTT
GGAGTTCAACTTTGAGTCGGGCTCCGGCTCGCACTTTGAG
TTCCCCGACTACTGCACACCAGAGGTGAGCGAGTTGATGA
TATCAGGGGACTGGCTCGAATCCACGATATCTAACTTGGT
GTTCACTTATTGAGCGCTAGTTATGAAAGGACAGCTTTGA
GAGAAAAAAAAAACACTCAAAATGACTGGAGGGCTGCAAA
CTCCTCCGAGACGAGTCAGACGACGAGTCAACGACATGAT
TCCTCGTGTTTATCATGCATCAGATACTGTGGGTTTTCAT
TATCCACTGACAAGAGTGCAGATGAAAGTGCTTAGCTTGC
TCGTTTGGTGCTGGAGGGAGGCGCGCTTTGGACGCAGAGG
AAGGCATTGCGCGGTGGCGAGTTGACGTTGTGCGCCCTCT
TCGACTTAAAAAGGGACGTTTTTAAAGAGAAAAAAAAGTC
TGGTCTGAATGCTTGTTGTGCTGGAGGTACTGAGCGGAGA
GCATGCGAGCGATTCATTTGCTCGCGCTTGAGATTGTTTA
CCAGAATCGTTTGTTAGACCAGAGTCGCATGCTTTCATTA
CGATTTAACTACGAAAGGCTGTCGAGAAGCGTAACTGATG
TTGATTGATTCTTTGAAACCGAATGGCAGACGCAAAAACA
AACACAATCACCAGCTTTTCTGTCGTCATGACATCAGGAT
TCAGACGCAACTCAGATGATTCGACTCTTTTACACTACAA
ATCAGGACCAAAATTCATCAGAGGAGCGTTTATTCTCTCT
CTCTCTATCTCTCTCTCTCTCTGTCTGCTTTTTACTTTTT
CATCCTCGAGTAACTTTTCTGCGCTGGCATTTTTATACTC
TCGATGTATTTATAACGGCCAAACATTGCTCCTCTAACTC
CCCTCAGTCCGTTGTGTTCTAGTCAGTCTGTTGTGTGTAT
AGGCTACTACACATGCACATGTCCGTCTGTCTCGCGGAAG
GGCTAGACTTGTTTCGTATTATTTAATTGATGACCTCTCA
CATGGAACGGAGATTAAATGTTTCATTATTTTCTGAGTGT
ATTTTTGTACAAAATCTATCGAGGGGGTGTCAATCGGTGA
ATATCGCTGTTTGGATTTCCGATTTTTAAAAGCAGGGGGT
TGGGTTGTCTCCAAAATCTGCCCCCTAAACATGTTTACAG
TGTCAATCCACAGGCTTCTTAAAGAGACAGTATCTGCATT
TCAACGACCAATCGTCATTAGCCTACGATGCGCGCGCTGA
GTGAGGTGTTTTATGTAGCTGCAGCAGCGAAGGCTGCGAT
TTATTGGGGATACTGTACCTTTTGAATACCGACTTCTTTG
TGCTTTTTCTAGTGACACGTTTCGGTTTGAACCACTGGAT
GGAATTACAGATACGGTCGAAATGCCTATAATTCATGAAC
AATGAAGTACATCTTCACTCCATAATTGTACAAGGATATT
TAATCTTTTCTACTTGTTGGCTAAATGTAGCTAATTGTTT
TAGTATATTATGGCATGGCGAATAGCATTTTGTATTTCTC
AATTCAGGTTTATGTAGAGCAGTTGTGTTTAAGGCAGAGG
ATCAACATGAAGATTTCTATGTACAATGACTGTAAAATAA
GTAAAAGATTGCGTGTTTATGTCTGACAATGATATATCAT
GACAGGAGCGAGAACATATATCTTTATACATCCCTATGTT
TAAGAGTGTTGTTCATGACTTTTGGAATATATAGATATGT
TTTATTGTTTCATTTTGTGCAATATGCTGTGTACAATATT
GTTTTGTCTTGCCATACCATATCTCAACATTTGAGTAGTG
AACTCAAAAAGCCAGCCAATTGTGTCAAGTCACTGCCTGT
CAGACCTCTGTACAGAACTTTGTCTTTTTCCAAGAAGGAA
ATAAAATCAGCTGGAACTGAA

sox4a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA sox4a-201 3261
sox4a-203 (1) 597
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sox4a-201 Contained in:

OTHER sox4a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000017993 (1)
  • Ensembl_Trans:ENSDART00000026992 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC065354 (1) 3350 bp
    GenBank:BC056564 (1) 3282 bp
    GenBank:AJ579375 (1) 3260 bp
    GenBank:AY369081 (1) 2961 bp
    GenBank:CN832544 (1) 854 bp
    GenBank:CK141239 (1) 772 bp
    GenBank:BM103328 (1) 587 bp
    GenBank:BM185099 (1) 554 bp
    CITATIONS (2)