Transcript

efcab1-202

ID
ZDB-TSCRIPT-120213-1070
Name
efcab1-202
Previous Names
  • efcab1-002
  • ch211-173p18.9-002
  • si:ch211-173p18.9-002
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054335 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054335|OTTDARG00000015444|ZDB-GENE-040914-40 efcab1|OTTDARP00000042683 CH211-173P18.9-002 LG_ BX510986.8 Danio rerio protein_coding KNOWN, 602 bp
CGATGAACAGAAAATTAATTCAAAACCTCGCCGAGACTTT
ATGCAGACAAGTCAAACATTTTAATAAAACAGAGACGGAG
TGTCTGATAAGGCTGTTCAACAGTCTGCTGGGAGAGCAGG
CAGAGAGAAAGACGACTATTGGAGTGGACCGGGCCAAATT
CAGAAATATACTGCACCACACTTTCGGGATGACCGACGAC
ATGATGACGGACAGAGTTTGTCGTGTCATTGACAAGGACA
ACGATGGCTACTTAAGCGTTAAAGAGTGGGTTGAGGCTCT
GTCTGTCTTTCTAAGAGGCACACTGGATGAAAAAATGAAA
TGTGTATGACCTGAACGGGGATGGATACATCTCACGTGAG
GAGATGTTTCAGATGCTGAAAGACAGCCTCATCAGGCAGC
CCACCGAAGAGGATCCTGATGAGGGGATTAAGGATATTGT
GGAGATTGCCTTGAAAAAAATGGATTATGACCATGATGGA
AGAGTTTCTTATGCTGATTTTGAGAAGACGGTCATGGATG
AAAACCTTTTACTAGAAGCTTTTGGAAACTGCCTTCCTGA
TGCAAAGAGTGTACTAGCATTTGAGCAACAGGCATTCCAG
AA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations