ZFIN ID: ZDB-TSCRIPT-120213-1070
Transcript Name: efcab1-202
Previous Names: efcab1-002, ch211-173p18.9-002, si:ch211-173p18.9-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054335 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054335|OTTDARG00000015444|ZDB-GENE-040914-40 efcab1|OTTDARP00000042683 CH211-173P18.9-002 LG_ BX510986.8 Danio rerio protein_coding KNOWN, 602 bp
CGATGAACAGAAAATTAATTCAAAACCTCGCCGAGACTTT
ATGCAGACAAGTCAAACATTTTAATAAAACAGAGACGGAG
TGTCTGATAAGGCTGTTCAACAGTCTGCTGGGAGAGCAGG
CAGAGAGAAAGACGACTATTGGAGTGGACCGGGCCAAATT
CAGAAATATACTGCACCACACTTTCGGGATGACCGACGAC
ATGATGACGGACAGAGTTTGTCGTGTCATTGACAAGGACA
ACGATGGCTACTTAAGCGTTAAAGAGTGGGTTGAGGCTCT
GTCTGTCTTTCTAAGAGGCACACTGGATGAAAAAATGAAA
TGTGTATGACCTGAACGGGGATGGATACATCTCACGTGAG
GAGATGTTTCAGATGCTGAAAGACAGCCTCATCAGGCAGC
CCACCGAAGAGGATCCTGATGAGGGGATTAAGGATATTGT
GGAGATTGCCTTGAAAAAAATGGATTATGACCATGATGGA
AGAGTTTCTTATGCTGATTTTGAGAAGACGGTCATGGATG
AAAACCTTTTACTAGAAGCTTTTGGAAACTGCCTTCCTGA
TGCAAAGAGTGTACTAGCATTTGAGCAACAGGCATTCCAG
AA

efcab1 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript efcab1-202 602
mRNA efcab1-201 (1)    Ensembl 771
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
efcab1-202 Contained in:
[BAC] CH211-173P18 (1)

Genome Resources: Vega_Trans:OTTDART00000054335 (1),  Ensembl_Trans:ENSDART00000150972 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EV564942 (1) 602 nt
CITATIONS (2)