Transcript

efcab1-201

ID
ZDB-TSCRIPT-090929-4104
Name
efcab1-201
Previous Names
  • efcab1-001
  • si:ch211-173p18.9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000018505 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000018505|OTTDARG00000015444|ZDB-GENE-040914-40 efcab1|OTTDARP00000015627 CH211-173P18.9-001 LG_ BX510986.8 Danio rerio protein_coding KNOWN, 771 bp
ACACGTTTCCACAGCAACATTCAACCAAAGACTAAAAAGA
GAGTAAAACATGCTGAAAATGTCGGCGATGAACAGAAAAT
TAATTCAAAACCTCGCCGAGACTTTATGCAGACAAGTCAA
ACATTTTAATAAAACAGAGACGGAGTGTCTGATAAGGCTG
TTCAACAGTCTGCTGGGAGAGCAGGCAGAGAGAAAGACGA
CTATTGGAGTGGACCGGGCCAAATTCAGAAATATACTGCA
CCACACTTTCGGGATGACCGACGACATGATGACGGACAGA
GTTTGTCGTGTCATTGACAAGGACAACGATGGCTACTTAA
GCGTTAAAGAGTGGGTTGAGGCTCTGTCTGTCTTTCTAAG
AGGCACACTGGATGAAAAAATGAAATACTGTTTTGAGGTG
TATGACCTGAACGGGGATGGATACATCTCACGTGAGGAGA
TGTTTCAGATGCTGAAAGACAGCCTCATCAGGCAGCCCAC
CGAAGAGGATCCTGATGAGGGGATTAAGGATATTGTGGAG
ATTGCCTTGAAAAAAATGGATTATGACCATGATGGAAGAG
TTTCTTATGCTGATTTTGAGAAGACGGTCATGGATGAAAA
CCTTTTACTAGAAGCTTTTGGAAACTGCCTTCCTGATGCA
AAGAGTGTACTAGCATTTGAGCAACAGGCATTCCAGAAAC
ACGAACACTGCAAAGAATAACCGGATTTTGAGGGAAAACA
ACAAATTGTCAAACAATATTTGATGCTGAAACTCAATAAA
TAACCAAAACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations