ZFIN ID: ZDB-TSCRIPT-090929-4104
Transcript Name: efcab1-201
Previous Names: efcab1-001, si:ch211-173p18.9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018505 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018505|OTTDARG00000015444|ZDB-GENE-040914-40 efcab1|OTTDARP00000015627 CH211-173P18.9-001 LG_ BX510986.8 Danio rerio protein_coding KNOWN, 771 bp
ACACGTTTCCACAGCAACATTCAACCAAAGACTAAAAAGA
GAGTAAAACATGCTGAAAATGTCGGCGATGAACAGAAAAT
TAATTCAAAACCTCGCCGAGACTTTATGCAGACAAGTCAA
ACATTTTAATAAAACAGAGACGGAGTGTCTGATAAGGCTG
TTCAACAGTCTGCTGGGAGAGCAGGCAGAGAGAAAGACGA
CTATTGGAGTGGACCGGGCCAAATTCAGAAATATACTGCA
CCACACTTTCGGGATGACCGACGACATGATGACGGACAGA
GTTTGTCGTGTCATTGACAAGGACAACGATGGCTACTTAA
GCGTTAAAGAGTGGGTTGAGGCTCTGTCTGTCTTTCTAAG
AGGCACACTGGATGAAAAAATGAAATACTGTTTTGAGGTG
TATGACCTGAACGGGGATGGATACATCTCACGTGAGGAGA
TGTTTCAGATGCTGAAAGACAGCCTCATCAGGCAGCCCAC
CGAAGAGGATCCTGATGAGGGGATTAAGGATATTGTGGAG
ATTGCCTTGAAAAAAATGGATTATGACCATGATGGAAGAG
TTTCTTATGCTGATTTTGAGAAGACGGTCATGGATGAAAA
CCTTTTACTAGAAGCTTTTGGAAACTGCCTTCCTGATGCA
AAGAGTGTACTAGCATTTGAGCAACAGGCATTCCAGAAAC
ACGAACACTGCAAAGAATAACCGGATTTTGAGGGAAAACA
ACAAATTGTCAAACAATATTTGATGCTGAAACTCAATAAA
TAACCAAAACA

efcab1 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript efcab1-202 (1)    Ensembl 602
mRNA efcab1-201 771
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
efcab1-201 Contained in:
[BAC] CH211-173P18 (1)

Genome Resources: Vega_Trans:OTTDART00000018505 (1),  Ensembl_Trans:ENSDART00000087474 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH466826 (1) 767 nt
GenBank:BC171473 (1) 709 nt
GenBank:BC171475 (1) 709 nt
GenBank:CK674431 (1) 582 nt
CITATIONS (2)