ZFIN ID: ZDB-TSCRIPT-110325-976
Transcript Name: kita-201
Previous Name: ottdart00000047646

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047646 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047646|OTTDARG00000033805|ZDB-GENE-980526-464 kita|OTTDARP00000037419 kita-001 LG_none BX942835.7,BX276097.13 Danio rerio protein_coding KNOWN, 3543 bp
CGTTCGGCGTTATTATCGAGCTCCAAGACTATACAACACA
CATGAGATAGATGGACTTATAACAATGGAATATCACTGCG
TTCTGTTTACTGTTTTGTTGCAGTTAATCATCCAACCAGG
CAGGTCGAGGCCTACCATTACCCCAGAAGGTCCCCGGCTA
ACAGTACCACTGTACAGCAACTTCAGTTTGCATTGCCAGA
GTAACAGTACAGTGCGCTGGCAGCATGAAAACCGTCCCAT
GCGTACCCTGAAGGAGGAACAAAGACAGGGTCAACAGACA
ATTCTTAAAGTAAACAGAGCCGGCCCTCAACACTTGGGCA
AATATTCGTGTAGAGAGGAGAAGACTGGTGAAAAGAGCTC
AATCTATGTGTATGTGAAAGATCCTGAAAATCCCTTCAGG
AGGACCATCGTGTTCGACATTGTTGCGGCAGAAGGAGATA
CGACGGTGATCCCATGCTTGGCAACAGACCCAGATATGAA
AAACTTGAACCTGCAGAAATGTGACGGACAGCCCCTTCCC
AACAGTCTGCGATATTCAGCCAGTCTTGAGACAGGAGTGT
CCGTGGAAAAAGTCAGGAAGGAATTTGAGGGATGTTACGT
CTGCGTCGGAACTTTGGATGCCGCTACGGTTAAATCAGGA
AGATATCAACTTACTGTTCGGCTTGTTCCAGACGCACCTC
CTCCGATCACACTGGGTCAGCCTCAAAGAGTGTTGCTCAC
CCAGGGGGAAAAACTCTCCCTATCCTGCTCCACCTCAAAT
GTCAACAGCGACATCGCAGTCAAGTGGAAGGCTCCAAACG
GAGTGAACCCGTCAGTACACCAGAACTCACATCTTCTGAC
GGAGCCCATTACTCACGTGAGGACGGCCATCCTCAGCCTG
AGCTCTGTGACCATGCAGGACGCCGGCAATTACAGCTGTG
AGGCCATAAATGAGAAAGGGACCACTGCAAAGCCAGTCTG
GGTCAACATCTATGAAAAAGGATTCATTAATATAACAAGT
GTGGATAACAGTACTAGGAGAGTGCGGGCTGGTGAAAGTC
TGTCTCTGCGAGTGGTAATGAACGCTTACCCAAAGCCGCA
TACTTTTTCCTGGAGCTACAGTGGTGTAAAACTTACCAAT
ACTACTGATCATGTGATCACCAGCCGGACACATGGAAATA
GTTACACCAGCGAGCTGAAGCTAGTGCGTCTCAAGGTGTC
AGAAAGTGGCATTTACACCTTTTCATGCTTAAACCGAGAC
GCAACTATCCGTCAAACGTTCGAAGTCCATGTCATCAGCA
AACCGCAGATTGTGTCCTATGAAGGGCCGATTGATGGACA
GGTGCGCTGTGTGGCCGAAGGTTATCCCACTCCTCAGATC
AAGTGGTATTACTGTGACCTGCCTCATTCAAGGTGCTCTA
ATCTACTGAATGCCACTCAGGAGGAGGAGGATGTTGTCAC
CGTGACCATGACAAATCCTCCCTTTGGGAAAGGCGCAGTG
GAGAGCCGTCTAAACATCACCAAGAACAATTACGCCACTC
TTGAATGCGTGGCATCTGCCAATGGGGAAATCGTGTACAC
ACTCTTCTCTATCAGCGAGAACACTGTTCCTCATGAACTC
TTTACACCGCTGCTCATCGGTTTTGTAGCCGCAGCTGTTA
TCCTTGTTCTCATCCTGATCGTGCTGACCTACAAGTACAT
GCAGAAACCCAAATACCAAATCCAATGGAAAGTCATAGAG
GGTATTCATGGAAACAACTATGTGTACATTGACCCCACTC
AGCTTCCATACGACCACCAGTGGGAGTTTCCCAGAGATAA
GCTGCGATTTGGAAAAACTCTTGGATCTGGAGCATTTGGA
AAGGTGGTGGAGGCAACGGCTTATGGGATGTCCAAAGCAG
ACACTGTGATGACGGTAGCTGTGAAGATGCTGAAACCGAG
TGCCCATGCAACAGAGAAAGAGGCTCTGATGTCAGAGCTG
AAGGTGCTTAGTTATCTTGGCAACCACATTAACATTGTCA
ACCTGCTTGGGGCATGCACTGTTGGAGGTCCAACTCTAGT
TATAACAGAGTACTGCTGTTTCGGCGACCTGTTGAACTTC
CTGCGCAGAAGGAGAGTATATTTCTACTACACAACACTAG
GCGAAGATGCTTACTATAGAAATGTCATGATGCAGTCAGA
ACCAAATGACAGCAGAAATGGATACATGACCATGAAGCCC
TCTGTACTGGGAATCCTGTCCTCCGAAAACAGACGATCAC
TTAATAAAGGGGATTCGTACAGTGATTCTGATGCCGTCAG
TGAGATTCTGCAGGAAGACGGCTTGACTCTGGACACTGAG
GATCTTCTCAGCTTCTCCTACCAAGTAGCCAAAGGGATGG
ATTTTCTAGCATCAAAAAACTGTATTCACAGAGACCTGGC
TGCCAGAAACATTCTCCTCACCCAAGGCAGAGTGGCCAAG
ATCTGTGACTTTGGACTAGCACGAGACATCACAACTGACT
CAAACTATGTTGTCAAAGGCAATGCTCGTCTCCCAGTAAA
ATGGATGTCCCCGGAGAGCATCTTTGAGTGTGTTTACACC
TTTGAGAGTGACGTCTGGTCTTATGGCATCCTGCTGTGGG
AGATCTTCTCTCTTGGGAGTAGTCCATATCCAGGGATGCC
TGTGGACTCTAAATTCTATAAGATGATCAAGGAAGGATAT
CGAATGGAGTCTCCGGAGTTTTCCCCAAGTGAAATGTACG
ATATCATGCACTCGTGCTGGGATGCCGACCCTGTCAAGAG
ACCCTCATTTAGCAAGATAGTGGAGAAGATCGAACAACAG
ATTTCAGACAGCACTAAACACATTTACTTAAACTTCAGCT
CCAGGTTGCCAGCAGCACCAGGCCCCCGTGAGGAATCCAG
TTCTCATGTCCATCGGCTAAACTCAGTGGGCAGTCACAGC
ACAGCCACTCAACCTCTGCTCTCCAGCAACGACGTCTTTT
TGGATAGATCGAGTCCAAGTCACCCTGTAGTCTGAAAATC
CACTCTCAGCAAAAAGCGTCATCTTCTAAGACTCTCTGCG
TCATTGTAGCTGTCTGACATACGTGAGGACTTTGGTGAAA
AACACTGATCGTAAATCTCAAGAGCTGTCCGGCTCTTTCC
ACCTTTCTTGCAGACTGTGTATATAAGAAAGGACAGTGAT
GGTGTGCTTTCCTATTACCATTTCATGCATTCTTTGGAAC
TGTGGGACACTGAGTTTTCAAGAAAGCTAATAATCAATGC
TGGCATCATTCCATGGTACTATATCTCCAACGCGGATCTG
CAGGAGAACTGAACTCGTTTTCTATAAAATCCCTTCATTA
CTTGGGATGTATAAACCTAATAATGCTTCTTTTTGCTAGT
CGTCGAGTCTTTACACATGACAAAGTCAAAAGTCGGAGAC
AAGATCAAATCACGATGAGAACTTTGGAAATTCGACGTCA
TTTTGACATGATCTTTTAGCTGAAAATGCATTATATCGCA
CCTTTAACACTCGTGTGTTGAATATGACTCACTGAGTGTC
AGTAGTAAAAGTGTAAATCGCTG

kita TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA kita-001 (1) 3543
kita-201 3543
kita-202 (1) 3138
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
kita-201 Contained in:
OTHER kita-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000047646 (1)
  • Ensembl_Trans:ENSDART00000011135 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF153446 (1) 3545bp
    GenBank:CK026979 (1) 744bp
    GenBank:AL916596 (1) 447bp
    CITATIONS (2)