ZFIN ID: ZDB-TSCRIPT-110325-1883
Transcript Name: kita-202
Previous Name: kita-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047647 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047647|OTTDARG00000033805|ZDB-GENE-980526-464 kita|OTTDARP00000037420 kita-002 LG_none BX942835.7,BX276097.13 Danio rerio protein_coding KNOWN, 3138 bp
CGTTCGGCGTTATTATCGAGCTCCAAGACTATACAACACA
CATGAGATAGATGGACTTATAACAATGGAATATCACTGCG
TTCTGTTTACTGTTTTGTTGCAGTTAATCATCCAACCAGG
CAGGTCGAGGCCTACCATTACCCCAGAAGGTCCCCGGCTA
ACAGTACCACTGTACAGCAACTTCAGTTTGCATTGCCAGA
GTAACAGTACAGTGCGCTGGCAGCATGAAAACCGTCCCAT
GCGTACCCTGAAGGAGGAACAAAGACAGGGTCAACAGACA
ATTCTTAAAGTAAACAGAGCCGGCCCTCAACACTTGGGCA
AATATTCGTGTAGAGAGGAGAAGACTGGTGAAAAGAGCTC
AATCTATGTGTATGTGAAAGCATTCCTCTCAGCAGATCCT
GAAAATCCCTTCAGGAGGACCATCGTGTTCGACATTGTTG
CGGCAGAAGGAGATACGACGGTGATCCCATGCTTGGCAAC
AGACCCAGATATGAAAAACTTGAACCTGCAGAAATGTGAC
GGACAGCCCCTTCCCAACAGTCTGCGATATTCAGCCAGTC
TTGAGACAGGAGTGTCCGTGGAAAAAGTCAGGAAGGAATT
TGAGGGATGTTACGTCTGCGTCGGAACTTTGGATGCCGCT
ACGGTTAAATCAGGAAGATATCAACTTACTGTTCGGCTTG
TTCCAGACGCACCTCCTCCGATCACACTGGGTCAGCCTCA
AAGAGTGTTGCTCACCCAGGGGGAAAAACTCTCCCTATCC
TGCTCCACCTCAAATGTCAACAGCGACATCGCAGTCAAGT
GGAAGGCTCCAAACGGAGTGAACCCGTCAGTACACCAGAA
CTCACATCTTCTGACGGAGCCCATTACTCACGTGAGGACG
GCCATCCTCAGCCTGAGCTCTGTGACCATGCAGGACGCCG
GCAATTACAGCTGTGAGGCCATAAATGAGAAAGGGACCAC
TGCAAAGCCAGTCTGGGTCAACATCTATGAAAAAGGATTC
ATTAATATAACAAGTGTGGATAACAGTACTAGGAGAGTGC
GGGCTGGTGAAAGTCTGTCTCTGCGAGTGGTAATGAACGC
TTACCCAAAGCCGCATACTTTTTCCTGGAGCTACAGTGGT
GTAAAACTTACCAATACTACTGATCATGTGATCACCAGCC
GGACACATGGAAATAGTTACACCAGCGAGCTGAAGCTAGT
GCGTCTCAAGGTGTCAGAAAGTGGCATTTACACCTTTTCA
TGCTTAAACCGAGACGCAACTATCCGTCAAACGTTCGAAG
TCCATGTCATCAGCAAACCGCAGATTGTGTCCTATGAAGG
GCCGATTGATGGACAGGTGCGCTGTGTGGCCGAAGGTTAT
CCCACTCCTCAGATCAAGTGGTATTACTGTGACCTGCCTC
ATTCAAGGTGCTCTAATCTACTGAATGCCACTCAGGAGGA
GGAGGATGTTGTCACCGTGACCATGACAAATCCTCCCTTT
GGGAAAGGCGCAGTGGAGAGCCGTCTAAACATCACCAAGA
ACAATTACGCCACTCTTGAATGCGTGGCATCTGCCAATGG
GGAAATCGTGTACACACTCTTCTCTATCAGCGAGAACACT
GTTCCTCATGAACTCTTTACACCGCTGCTCATCGGTTTTG
TAGCCGCAGCTGTTATCCTTGTTCTCATCCTGATCGTGCT
GACCTACAAGTACATGCAGAAACCCAAATACCAAATCCAA
TGGAAAGTCATAGAGGGTATTCATGGAAACAACTATGTGT
ACATTGACCCCACTCAGCTTCCATACGACCACCAGTGGGA
GTTTCCCAGAGATAAGCTGCGATTTGGAAAAACTCTTGGA
TCTGGAGCATTTGGAAAGGTGGTGGAGGCAACGGCTTATG
GGATGTCCAAAGCAGACACTGTGATGACGGTAGCTGTGAA
GATGCTGAAACCGAGTGCCCATGCAACAGAGAAAGAGGCT
CTGATGTCAGAGCTGAAGGTGCTTAGTTATCTTGGCAACC
ACATTAACATTGTCAACCTGCTTGGGGCATGCACTGTTGG
AGGTCCAACTCTAGTTATAACAGAGTACTGCTGTTTCGGC
GACCTGTTGAACTTCCTGCGCAGAAGGAGAGTATATTTCT
ACTACACAACACTAGGCGAAGATGCTTACTATAGAAATGT
CATGATGCAGTCAGAACCAAATGACAGCAGAAATGGATAC
ATGACCATGAAGCCCTCTGTACTGGGAATCCTGTCCTCCG
AAAACAGACGATCACTTAATAAAGGGGATTCGTACAGTGA
TTCTGATGCCGTCAGTGAGATTCTGCAGGAAGACGGCTTG
ACTCTGGACACTGAGGATCTTCTCAGCTTCTCCTACCAAG
TAGCCAAAGGGATGGATTTTCTAGCATCAAAAAACTGTAT
TCACAGAGACCTGGCTGCCAGAAACATTCTCCTCACCCAA
GGCAGAGTGGCCAAGATCTGTGACTTTGGACTAGCACGAG
ACATCACAACTGACTCAAACTATGTTGTCAAAGGCAATGC
TCGTCTCCCAGTAAAATGGATGTCCCCGGAGAGCATCTTT
GAGTGTGTTTACACCTTTGAGAGTGACGTCTGGTCTTATG
GCATCCTGCTGTGGGAGATCTTCTCTCTTGGGAGTAGTCC
ATATCCAGGGATGCCTGTGGACTCTAAATTCTATAAGATG
ATCAAGGAAGGATATCGAATGGAGTCTCCGGAGTTTTCCC
CAAGTGAAATGTACGATATCATGCACTCGTGCTGGGATGC
CGACCCTGTCAAGAGACCCTCATTTAGCAAGATAGTGGAG
AAGATCGAACAACAGATTTCAGACAGCACTAAACACATTT
ACTTAAACTTCAGCTCCAGGTTGCCAGCAGCACCAGGCCC
CCGTGAGGAATCCAGTTCTCATGTCCATCGGCTAAACTCA
GTGGGCAGTCACAGCACAGCCACTCAACCTCTGCTCTCCA
GCAACGACGTCTTTTTGGATAGATCGAGTCCAAGTCACCC
TGTAGTCTGAAAATCCACTCTCAGCAAAAAGCGTCATCTT
CTAAGACTCTCTGCGTCATTGTAGCTGTCTGACATACGTG
AGGACTTTGGTGAAAAACACTGATCGTAAATCTCAAGAGC
TGTCCGGCTCTTTCCACC

kita TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA kita-001 (1) 3543
kita-201 (1) 3543
kita-202 3138
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
kita-202 Contained in:
OTHER kita-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000047647 (1)
  • Ensembl_Trans:ENSDART00000110967 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC162502 (1) 3138bp
    GenBank:CU458898 (1) 2942bp
    CITATIONS (2)