header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-914
Transcript Name: dbt-202
Previous Name: dbt-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000020090 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000020090|OTTDARG00000016703|ZDB-GENE-050320-85 dbt|OTTDARP00000047643 dbt-001 LG_none CR751228.20,CR936359.9 Danio rerio protein_coding KNOWN, 2374 bp
ATATCAGAAATGTCTGGAAAAAAATTTGCCCTTGGCCAAA
AAACTCACGGATTGGTCAGCAAAGCGGGGCGTGCGAGTGA
CGTCATTTCCGGTTGCATCAAATCGCTGGGGAAAGATGGC
GGCGGTCATTACTGTGCGGGCTCCATTCGTGTTTATGAGA
CGCCTGGTCTCTGCACGCCTGCACAGAAACTGCTGCTCTA
AACTGCCAGCCGCTTGTCTTGTACTCAGACCTCACTCGTA
TTCCCTCGTTGCTGGAAGGCAGCATCGCTATTTTCACACT
AGCTATGTCACAGCTCGACCAATTGTACAGTTCAAACTCT
CCGACATTGGGGAAGGAATTATGGAGGTGACGGTTAAAGA
ATGGTATGTGAAAGAAGGCGATAAAGTCTCTCAGTTTGAC
AGTATCTGTGAAGTGCAGAGTGACAAAGCCTCTGTCACCA
TCACCAGCCGATATGACGGAGTAATCCGCAAGCTCTACTA
CGATGTCGATTCCATTGCCCTCGTCGGTAAACCTCTCGTG
GACATCGAAACGGACGGCGGTCAGGCTGAAAGTCCTCAGG
AGGACGTGGTGGAGACGCCTGCTGTGTCCCAGGAAGAGCA
CACGCATCAGGAAATCAAAGGACACAAGACTCAAGCCACT
CCTGCGGTCAGACGCCTAGCCATGGAGAATAATATCAAAC
TAAGCGAAGTTGTCGGCACTGGAAAAGATGGACGCATTCT
CAAAGAAGACATCTTGAACTTCATCGCCAAACAAACTGGG
GCCATTTTACCTCCAGCACCCTTCCAGGAGATTCGTCCTC
CACCTCCTGCGGCTGCAGCACCTTTAACTCCATCTGCAAA
GGCAACTCCACCGAGTGTACCTATTCCTGTGATCCCTAAA
CCTGTGTTTACGGGCAAAGACCACACTGAACCTATTAAAG
GCTTTCAGAAGGCGATGGTTAAGACCATGTCAGCAGCACT
GAAGATCCCTCACTTCGGCTATAAAGATGAAGTAGATCTG
AGCCAGTTGGTCCGGTTGCGCTCTGAACTCAAAGGTCTGA
CTGAATCACGAGGAGTGAAGCTCAGCTACATGCCCTTCTT
CATCAAGGCAGCGTCACTCGCCCTTCTCCATTTTCCCATT
CTCAACTCGTCTTTGGATGAAAACTGCACAAGTATCACCT
ATAAGGCTGCTCATAATATCGGACTGGCGATGGACACAAG
TCAAGGTCTTCTGGTTCCCAATGTCAAGAACATACAGATG
CTTAGTGTTTTTGAGATCGCAGTGGAGCTCAACCGCCTTC
AGATATTGGGAGCATCGGGACAGTTGGGGACCTCTGACCT
CACAGGGGGAACGTTCACACTCTCAAACATTGGATCAATT
GGAGGAACCTATGCAAAGCCGGTCATATTGCCGCCTGAGG
TTGCTATTGGTGCTCTTGGGAAAATTCAGGTTTTACCTCG
CTTTAACCACAAGGACGAGGTAGTGAAAGCACACATCATG
AACGTCAGCTGGTCTGCAGACCACCGAATCATCGACGGAG
CCACCATGTGTCGCTTCTCCAACCTGTGGAGATCGTACCT
GGAGAACCCTGCCTCCATGGTCCTCGATCTGAAATAGAAA
GCATACATCCTCCAACCACATCTAGACTCCGTGTGACTCC
ATATCCCGCCCCTAAAGAGTTTTTCCGTTAAACTGGGACA
CTGAGCTTTTTGAATCTTCATGACACGTTTGAAGAAAATT
TCCACAACGGCATCAAGCTAATAACTGGCGTTTTGTTGTT
TTTTTTCTTGTGGTTTATTCTCCTCTCGTTGCCTTACTGA
TAAAAGATGTTACATCTACCAGAGCGTATTGTGAACTGTT
GAATGTTAGAGAATATGAACTTAATGTAGCAATATCGCAT
ACCCACAATTTTTCATTTTCTACATACTTTAAAATCTCCA
ATGGTGTTGCACAAGGGTTTTAAAATCAGCTATGAGCTAG
CAATTATGTCTACAATGTCACCCTATAATCAAACAAAAGA
AATTATATTTTGTAAAAAGAAAGTTTATAGAAATATTATT
ACTATTATTATTATTATGTCTTTTTAAAACGTTGTATTTA
AAAATGTCTTCTTGACGCAAAATATAATTTCTTTTTTGGG
AATGAGACATGTTCATGATTCATGTTTTTTCAGTGCTGCT
TTTCTTTCCAGTCATTGTTTTTATTAAATATATGTGATTC
AAAATGGTTGTGGGGAATCTGCATTGAGACATTTTCTCAT
CTCCAGTGTGATGATTTAGTTGGCGTGTTCTGCCACTCCT
GAATGATGGGAAATTCGTCATTGGATATTTGTGTGAGTGT
GTGTGTGTGTGCGAATCTGCAAATTAGTGTTTTAATAAAT
TGTACATTTAAGGA

dbt TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA dbt-202 2374
ncRNA dbt-002 (1) 502
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dbt-202 Contained in:
[BAC] DKEY-168J9 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000020090 (1),  Ensembl_Trans:ENSDART00000170960 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC090917 (1) 2320 bp
GenBank:CA473905 (1) 959 bp
GenBank:CN321142 (1) 896 bp
GenBank:CN331850 (1) 890 bp
GenBank:CK706408 (1) 813 bp
GenBank:CK707389 (1) 797 bp
GenBank:DN769164 (1) 797 bp
GenBank:CV488188 (1) 793 bp
GenBank:CV486600 (1) 787 bp
GenBank:CF998045 (1) 781 bp
GenBank:CF995990 (1) 774 bp
GenBank:DR718351 (1) 770 bp
GenBank:CK705135 (1) 763 bp
GenBank:DT071741 (1) 748 bp
GenBank:CV113049 (1) 740 bp
GenBank:BM776211 (1) 680 bp
GenBank:CK679030 (1) 663 bp
GenBank:CO352322 (1) 660 bp
GenBank:CD599629 (1) 650 bp
GenBank:CK684702 (1) 607 bp
GenBank:BI867852 (1) 541 bp
CITATIONS (2)