header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-2301
Transcript Name: dbt-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049341 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049341|OTTDARG00000016703|ZDB-GENE-050320-85 dbt|no_translation dbt-002 LG_none CR751228.20,CR936359.9 Danio rerio protein_coding KNOWN, 502 bp
GGAAAAGATGGACGCATTCTCAAAGAAGACATCTTGAACT
TCATCGCCAAACAAACTGGGGCCATTTTACCTCCAGCACC
CTTCCAGGAGATTCGTCCTCCACCTCCTGCGGCTGCAGCA
CCTTTAACTCCATCTGCAAAGGTCTGACTGAATCACGAGG
AGTGAAGCTCAGCTACATGCCCTTCTTCATCAAGGCAGCG
TCACTCGCCCTTCTCCATTTTCCCATTCTCAACTCGTCTT
TGGATGAAAACTGCACAAGTATCACCTATAAGGCTGCTCA
TAATATCGGACTGGCGATGGACACAAGTCAAGGTCTTCTG
GTTCCCAATGTCAAGAACATACAGATGCTTAGTGTTTTTG
AGATCGCAGTGGAGCTCAACCGCCTTCAGATATTGGGAGC
ATCGGGACAGTTGGGGACCTCTGACCTCACAGGGGGAACG
TTCACACTCTCAAACATTGGATCAATTGGAGGAACCTATG
CAAAGCCGGTCATATTGCCGCC

dbt TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA dbt-202 (1)    Ensembl 2374
ncRNA dbt-002 502
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dbt-002 Contained in:
[BAC] DKEY-168J9 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000049341 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CT718039 (1) 502 bp
CITATIONS (1)