Transcript

acsl5-203

ID
ZDB-TSCRIPT-110325-830
Name
acsl5-203
Previous Names
  • acsl5-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000050854 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050854|OTTDARG00000035704|ZDB-GENE-040912-169 acsl5|OTTDARP00000039933 acsl5-002 LG_ CU459185.9 Danio rerio protein_coding KNOWN, 762 bp
CAGGACAGGGGGGACCAAATAACGCGGACACATTTTGCTC
CATTACTTGCTCGATGAAACCCCTCAGTGAGGTTTTGGCG
TTACAGTCTGTGTCCATGTAGACGAAGTCAAAGGTGAAGT
TTCCACTGAGAGCTGGATTTGAGTTGATCTTGTCCATGGC
TATTTGCATCGCTGACCCCAGCCTGAGCAAACTGAAAGGT
TGCTCTTGCAGACGCTGTAGATTATGGAGTTCCTGTTTGA
GTTTCTTTTCACGCCGCTGTCCACCTCAGGACTGGTGTTT
TTGTTCAGTCTCGCAGCAGTAGCCCTGGTTCATCTCAACA
CAAGGCCGAAACCACTGCAGCCACCGACAGATCTTAACCG
GCAGACTGTAGGTGTAGCGGGTGGAGCTAGAAAATCAGCG
CTTTTGAAATCTGACAACTTGATCTCATACATGTACGAAG
ATGGCAAAACGCTCTATGAAGTTTTTCAAAGAGGACTACG
TGTCTCAGGAAATGGACCGTGTTTGGGATTCAGGAAGAAA
GGGCAACCTTATCAGTGGCTTAAATACAAACAGGTTTCTG
ACAGAGCTGAGTTTTTGGGCTCCGGACTGATCCACCGCGG
ACAAAAACCTTCACAAGATACATTTATTGGCATCTTTGCC
CAGAACCGACCAGAGTGGATTATCGCAGAACTGGCCTGCT
ATACCTATTCCATGGTGGCAGTGCCTCTTTACGACACCTT
GGGACCTGAGGCTCTTGTGTTCATCATTAATAGAGGTACT
TA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations