Transcript

acsl5-202

ID
ZDB-TSCRIPT-110325-2645
Name
acsl5-202
Previous Names
  • acsl5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000050853 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050853|OTTDARG00000035704|ZDB-GENE-040912-169 acsl5|OTTDARP00000039932 acsl5-001 LG_ CU459185.9 Danio rerio protein_coding KNOWN, 3394 bp
AGTCTTCTTGTGGCTGTTGCAAACCTCTACAAGGGACTCT
CTCTCAGGATATTTTCTCCCAGTTTCAACTCTCGACGTAC
ACACTGGACACCTGCAGGTTACAAAGCTTTTAGCATCCTG
AAAGTTGCTCTTGCAGACGCTGTAGATTATGGAGTTCCTG
TTTGAGTTTCTTTTCACGCCGCTGTCCACCTCAGGACTGG
TGTTTTTGTTCAGTCTCGCAGCAGTAGCCCTGGTTCATCT
CAACACAAGGCCGAAACCACTGCAGCCACCGACAGATCTT
AACCGGCAGACTGTAGGTGTAGCGGGTGGAGCTAGAAAAT
CAGCGCTTTTGAAATCTGACAACTTGATCTCATACATGTA
CGAAGATGGCAAAACGCTCTATGAAGTTTTTCAAAGAGGA
CTACGTGTCTCAGGAAATGGACCGTGTTTGGGATTCAGGA
AGAAAGGGCAACCTTATCAGTGGCTTAAATACAAACAGGT
TTCTGACAGAGCTGAGTTTTTGGGCTCCGGACTGATCCAC
CGCGGACAAAAACCTTCACAAGATACATTTATTGGCATCT
TTGCCCAGAACCGACCAGAGTGGATTATCGCAGAACTGGC
CTGCTATACCTATTCCATGGTGGCAGTGCCTCTTTACGAC
ACCTTGGGACCTGAGGCTCTTGTGTTCATCATTAATAGAG
CAAACATATCCACAGTGATATGCGATAAGAAGGATAAAGC
AGAAACACTTCTGGATAACTCTGAGAAAAAACTCACCCCC
CTGTTGAAAACCATCATCCTCATGGACTCCTATGACAGCG
CATTGACCGAAAGAGGCTCTAAGATTGGGTTGGACGTCCT
GTCTCTAAAAGATGTAGAGGCCCTGGGAAAGAACAACCAT
CACAGACCTGTTCCCCCAAAGCCAGAAGACCTAAGTATTA
TTTGCTTTACCAGTGGAACCACGGGGGATCCAAAGGGAGC
CATGCTGACCCATGAAAACGTGGTTGCAGATGCAGCTGGT
GTGGTTAGAACCTTTGAGAGCGTCTTTGTGCCCGTTCCAT
CCGACGTGTCCATCTCGTTTTTGCCGCTGGCACACATGTT
CGAGAGGGTTGTACAGACAGTGCTGTACGGTGTGGGGGGA
AGAGTTGGCTTTTTCCAAGGTGATATCAGACTTTTACCAG
ATGACATGAAAGCCCTGCAGCCGACAGTATTCCCAGTGGT
TCCACGTCTTCTGAATCGTGTTTATGACAAGGTCCAAAGT
GGGGCCAAGACTCCATTTAAGAAGTGGCTACTGAACTTTG
CCATTGAGAAGAAATGTGCGGAAGTCAAGCAGGGCATTAT
CAGGAACGACAGCATGTGGGACAAACTCATCTTTCACAAA
GTGCAGGAGTCTCTCGGAGGCCGTGTGAGAGTGATGGTGA
CTGGAGCTGCTCCTATTTCTCCATCTGTGCTCACTTTTCT
CCGGGCATGTCTTGGGTGCCAGATATTTGAGGCATATGGC
CAGACAGAGTGCACTGCGGCCTGCTCTTTCACCATACCAG
GAGACTGGAAAACTGGGCATGTTGGAGCTCCTATTCCATG
TAACACTATCAAACTTGTTGATGTTGAGGAAATGGACTAC
TTTGCATCCAATGGTGAAGGAGAGATTTGCGTCAAAGGGA
CAAATGTTTTCCGTGGGTATCTCGGTGATCCAGAAAAAAC
AGCAGAGGCTTTGGACAAAGATGGGTGGCTTCACACTGGC
GATATTGGCAAATGGCTTCCTAGTGGGGTGCTGAAGATCA
TTGACAGGAAGAAGAATATCTTCAAACTGGCCCAGGGTGA
ATACATTGCACCGGAAAAGATTGAAAATGTTTACATTCGC
AGCGCTCCAGTTGCCCAGGTGTTTGTACATGGTGAAAGTT
TACAGTCCTCTTTGGTGGCCATAGTGGTGCCAGATCCTGA
AGTATTGCCAGGTTTCGCAGAGAAACTGGGATTGAAAGGT
TCACTAGAAGAGCTATGTAGAAATCAGGAACTCAAAAAAG
CAATCATCTCTGACCTCAACAAGCTGGGTCGTGAAGCAGG
GCTGAAGTCTTTTGAACAAGTAAAAGACCTGTACCTGCAT
CCCGACATGTTCACTATAGAAAATGGCCTCCTCACTCCAA
CACTCAAAGCCAAACGGGCAGATCTCACCAAATACTTCAG
AGTTCAGATCGAGAGTCTTTACGCCAACATGTAGTGCACT
AAAAAAAAAGTTTCACATATTTATGAGTGCTGTTTGTATT
GTGTTTTTTCTATATTTGCTAAAAGATAACATATTTTGTC
AGCACTGCACTGTATCAGCCCTCACTGCATTTATTAACCT
ATTCCCAACACACTCTCCTTGTCAGTCAGAAAGAAATAAA
AGCATTGTCTGGTTCTATTTGAAAGCAATTGTACAAACAG
CCTTACAAATTGAAAGAATTTTCATTTATTTTGGTTTTCC
CATCAGAGAAAATGTTAATACGACATTGAAATGTGATATT
TGAGGTATACACTGCTAAAAAAGCTTTACTTATGTCAGGG
GTGTCTAAACTCAGTCCTGGAGGGCCGGTGTCCCGGAGAG
TTTAGCTCCAACCCTAATCATACACACCTGAACCAGCTTA
TCAAGCTCTTACTAGATATACTAAAAACTTTCTGCCAGGT
GTGTTGAAGTTGGAGCTAAAATCTGCAGGACACTGGCCCT
TTCCGGGCTGAGTTTGGACGCCTCTGTTGTAGTTTATCTA
GTTACAACTTGATTAGCTGGTTTAGATGTGTTTAATTAGG
GTTGGAGCTAAACTCTCCAGGACACTGGCCCCTTCCGGAC
CAAGTTTGGTCACCCTGACTTATGTGGAGTTGTTTTCATG
TTTGTAGTTCAAATATCTAAAAATTATTAAATTTAGAAGT
ATTTTCTAGACATGGTAAACATATTGCCTTGTTTTCAAAA
AGTCAAAATTAAAATGAAATTAAAAATGAGTTTTTCCCTT
AAATCAAGCTAAAAAATCTGGTTTCTGCTTTGAATCGTTT
TTTTTTTACTTACCCCATTAGTAAATTATTTACCCTATGA
TTTTATTTTGGCTCATTATTTCTGAAAATAAGGCAATATT
ATTTGCTTGTCTAGAAAATGCTTTAAGATTTAAGATACTT
TAACATATTTGGACTAGAGATGCACTCAAAAATGACTTTT
GCTGCTTGTTTAAACTACTTATTTAAACTAAGTGGAAGTT
TTTTTGGGACAACTTACATTTAATCTACTTAAATTTGTAA
AAACATTTAAGTTTACATGAAGGATTTTTGTGGAACTCAG
CATTTTTACAGTGCAAGACAACTCTAAATAAGGAACACAT
TTTTTGCAGTGTAGAAACTAGTGTTGTTGTTGCGTTCTAT
TAAAAAAATGATGAAAATAAAATGAGGAAATGAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations