Transcript

adam8b-202

ID
ZDB-TSCRIPT-110325-817
Name
adam8b-202
Previous Names
  • adam8b-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000050813 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050813|OTTDARG00000035678|ZDB-GENE-070808-1 adam8b|OTTDARP00000039898 adam8b-002 LG_ CR854953.8 Danio rerio protein_coding KNOWN, 741 bp
TTAACTAATGCATTTATTAATGATTATCGATTAATGCTTC
GATATCGCAGTGTAATCATTCGCAATAGTCTCTGTGGCAA
GGGGGCAGGGCCCAGAGCCGTGGGAACGTAATGAGACTGC
TGTGTAAGTGGATTCACCTGTAGCGCGCACTGGTCTCGAA
TCCTAAGGAAGGAGCTCTGGACTTTAAGAGGAGGAACGAT
GGCAAAAGTAAAACAATCTGTTTGGGCCCGGTCCACTCTC
GGGTTCCTCGGCCATCGTTCCTCATCTGGTGAAATTGTAT
TTAGATTGCAATATATATTGCAAAATAAAAAAAAATCTCA
ATATCGTGCAGCCCAACTATTAACAGTTTTTTTTTTTTTC
CTCTAGTGGAATTGATTTTTTGGGTGACACAGTTGGGTTG
GCAAACAAATTTGCAATGTGTGCCGAAAGCTCAGCAGGAG
TCAATCAGGATCATAATCAGAACCCACTGGGCCTGGCATC
CACAATTGCACATGAGATGGGTCATAACATGGGCATGTCC
CATGATGAGGATCACTGCACGTGTGGCTCGTCAGTGATCA
GTTCCTTCTGTATCATGACAGAGCGTGTGGGCACGCTGTT
CCCAGAGCAGTTCAGTGACTGCAGTCTAGAGCAGCTGACT
GTATTTCTAGACAACGCCAACCCTAGCTGTCTGCTGGACA
CCCCCAGCTCATACAAACTGTACAGTGGGCCTGTCTGTGG
TAATGCTTTCCTGGACCCTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations