ZFIN ID: ZDB-TSCRIPT-110325-2632
Transcript Name: adam8b-201
Previous Names: adam8b-001, ottdart00000050812

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050812 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050812|OTTDARG00000035678|ZDB-GENE-070808-1 adam8b|OTTDARP00000039897 adam8b-001 LG_ CR854953.8 Danio rerio protein_coding KNOWN, 3402 bp
ATGCCGTGTCCTGCCTTCACAGCTCATATACTTTGCTGGC
TTTGTCTTTGTGGATGTGTGGCAGAAAGTATCCGTACATT
ACCTCATGTTGAGCGTTTTGATGTGGTGAGACCTAAAAGA
CTGAACCTCAGTAAGGTACAGTCTGATAAAAATCCACCAA
GCCATGAGAAGTATCCTGACAGACTCGCATATAAATTATT
CTTTGAAGGAGAAAATCATGTGATTCACTTGGAAAAGAAC
AAGCAACTCGTTGGACATAATTACACTGAAATATACTATC
AAGATGACGGATCAATTGTGAGCAGAAATCCAAGTTTTAA
GGACAATTGCTACTACCATGGGCACATTCAAGATATGGAA
TATTCCTCAGTCAGCGTGGGAATCTGTTCTGGGATCAGAG
GTTTTGTCAGAGTGAAACAACAAGTCTATCTGATTGAGCC
CCTAGCTAACCACAGTGATGGAGATCATGCACTTTATAAA
CACCAGCATCTGAGGAGAAGGAGAAGCTCTGCTGGTGAAC
CGAAAACCATGTTTTATGACCACGAACCACAAGTGAGCGC
TGCCTTAAAGTCGAGCAGATGGAATATGAAGAGTTTTCAA
ACTCCAAGATTTGTGGAATTATTTCTGGTGGTCGATAACA
CTGAGTACAGAAACTTTGGCTCTAGCATGGATTCTATCAG
AGCCAGGATGCTGGAGGTGGTAAATCACGTTGACAAGTTG
TATCGATCTCTTAATATCCGAGTGATGTTGGTGGGTCTTG
AGGTCTGGATGAAACAGGACCAGATTGTGGTCAGTGTGAG
TTCTGATGACACTCTCAGTCGCTTTATAGAATGGAGGAAG
AGCAATCTGCTTAAAAGGGTCAAACATGACAACGCTCAGT
TTGTGACTGGAATTGATTTTTTGGGTGACACAGTTGGGTT
GGCAAACAAATTTGCAATGTGTGCCGAAAGCTCAGCAGGA
GTCAATCAGGATCATAATCAGAACCCACTGGGCCTGGCAT
CCACAATTGCACATGAGATGGGTCATAACATGGGCATGTC
CCATGATGAGGATCACTGCACGTGTGGCTCGTCAGTGATC
AGTTCCTTCTGTATCATGACAGAGCGTGTGGGCACGCTGT
TCCCAGAGCAGTTCAGTGACTGCAGTCTAGAGCAGCTGAC
TGTATTTCTAGACAACGCCAACCCTAGCTGTCTGCTGGAC
ACCCCCAGCTCATACAAACTGTACAGTGGGCCTGTCTGTG
GTAATGCTTTCCTGGACCCTGGAGAGGAGTGTGACTGTGG
ATCAGTGGAGGAATGTAAAAATCCATGCTGTGATCCCATG
ACCTGCAAGCTCACTGAAGGTTCACGCTGTGCTCAGGGAG
ACTGCTGTGAGAATTGCCAGATAAAAGATGCTGAAAGCTT
GTGTCGAGCATCTATAAATGAGTGTGATGTTCCGGAGTAC
TGCACAGGGCTTTCGGAGAAGTGCCCTGAGAATGACTTCA
GGATGAATGGCATACCTTGCAGCTCTGGCCAGGGTTACTG
CTACAATGGCCAATGCCCCACTCATCTCCAGCACTGCCAA
AGGCTTTGGGGAACAGGTGCCAAAGTGGCTCCTGACACAT
GCTTTTACCAGAACACATTAGGAAAAAATGATTCTCACTG
TGGAAAAACCAAAGATGGCATCAGACCCTGTGCAAGAGAA
AACATGTTTTGTGGAAAGATCTTTTGCAATGAAGGAAATG
AATTCCCCGTTACTGGTCAGAAAGCGGTCATAGTAACATT
AAGAGGACAGTGCAACGTAGCAGGGGACCAAACAGAGGAG
GACGCGCTCAGCATGGTTCCAACTGGCACAAAATGTGGGC
ATAATAAGGTTTGCTATGATTATAAGTGCCAAGAATTGAA
CATTTATGGTAGCATTGAAGGCTGTTCACTGCAGTGCAAT
GGTCGAGGGATTTGTAATCATAAAAAACAATGCCACTGTG
ATCCAGGCTGGGCACCACCTTACTGTAATGTCAAATATTC
TGAATTGTCATCTGCAAAGACCATTGGCATCTCAGTAGCT
GTTGCAGTCGCTGTGCTTGTGGTAATATGTGGAGCCGTGC
TTTATCATAAAAAAAGAAAAGCCATCAGCCGCCACAAGAC
GCAAACTCCAACTTCAGGGCAAACGAGTCTTCTTTTTGAG
AACAACAGTGCCCAGAAGGACCGTCCTGAGATCAGTCAGC
CTATATTCATGGGGACCACTGTATCTCAACCCTGCACCCC
TCTAACTGCCAGAGTGGGTCCGACCCGTCCTGCTCCACTA
CCTCCAAAAAAGCCGCCATCACAACCCCAGCAGACCACAG
TTACACAGGGAACGAAGTTGCCTGCACCTCCAGTTCCTCC
AGTAAAACCATCTTTAGCAACAGGATCCTGGAGGAATGAC
CATGTGACAGAAGACACAGTGAAGGTTGTGTTGAAACCTC
CCATCATGCCAAGAAGATGACCAGACCTGAAATCCCCCTG
TGAGTCATTTCAGGAAATTAGAACCTTTCTCTGTCACTTT
TATAGAGTGGGAGTGTCTGAATCACAAAGTGCTTTTTTTA
AACCATGCTTTAAAAAACACACATACACTGCTGTGCTTGG
CCTTAGCTGCGTGTTGTCTGTTAGTATATAGTTAAATTAA
AATTATTCCCCCTCCTGTGATTTCTTTTTTTCTTTTTTAA
ATATTTCTCAAAGAATGTTTAACAGAGCAAGGATTTTTTT
TTCATAGTATTTCCTAAAATATTTTTTCTTCTGGAGAAAG
TCTTAGTTGTTTTATTTCGGCTAGAATAAAAGCAGTTTTT
AATTTTCTTTAAAACCATTTTAAGGTCAATATTATTAGCC
TCTTTATGCTATATATTTTTCGATTGTCTACAGGGCAAAT
CACTTTTTTACAATGACTTGCCTATTTGACCTAATCTGCC
TAGTAAACCTAAGTAGCCTAGTTAAGAATTTAAATTGCAC
TTTAAGCTGAATACTAGTATTTAGTAAAATATTATATACT
GTCATCATGACAAAGATAAAATAAATCAGTTATTAGAAAT
GAGTTATTAAAACTATTATGTTAAGAAATGTGTTGAAAAA
AAATCTTCTCTCCATTAAACAGAAATTGGGGAAAAAATAT
ACAGGGGGCTAATAATTCAGGATGGCTAATAATTCTGATT
TTAACTAAGTCAAAATTATTAGCATTATTAGCTCCCCTTT
TGATTTTTTTTCTTTGTTTTTAAATATTTCCTAAATGATG
TTTAACAGAGCAAGGAAATGTTCACAGTATGTCTAATAAT
ATTTTTTCTTCTGGAGAAATTCTTATTTGTTTTATTTTGG
CTTGAATAAAAGAAGTTTTTAATTTTGTAAAAACTATTTT
AAGGTCAAAATTATTAGCCCCTTTAAGCTATATTTTTTCC
TC

adam8b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA adam8b-201 3402
adam8b-202 (1)    Ensembl 741
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
adam8b-201 Contained in:
[BAC] DKEY-14G24 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000050812 (1),  Ensembl_Trans:ENSDART00000066471 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK028147 (1) 1117 nt
GenBank:EE302004 (1) 870 nt
GenBank:CK237845 (1) 714 nt
GenBank:BI876029 (1) 421 nt
GenBank:EB991537 (1) 368 nt
CITATIONS (2)