ZFIN ID: ZDB-TSCRIPT-110325-786
Transcript Name: anxa11b-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050670 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050670|OTTDARG00000035587|ZDB-GENE-030707-5 anxa11b|no_translation anxa11b-002 LG_none CU611055.2,FP103002.4 Danio rerio protein_coding KNOWN, 771 bp
GTGTGTGTGTGTGTGTGTGTGGTTTTCTCCTGCAGAAACT
CTACAGTGCTGGAGAGAATAAAGTGGGCACAGACGAGTCT
CAGTTCAATGCCATTCTCTGTGCCCGCAGTAAACCTCACC
TCAGACAGGTGTTTCAGGAGTACCAGCAGATGTGCGGTCG
GGACATCGAGAAGAGCATCTGCAGAGAGATGTCTGGAGAC
CTGGAGTCCGGCATGGTGGCAGTGGTGAAGTGCATTAAAA
ACACTCCTGCCTACTTTGCTGAACGCCTCCACAAGGCCAT
GCAGGGCGCAGGAACTAAAGACCGGACTCTGATCCGCATC
ATGGTTTCCCGCTCTGAGCTGGACATGCTGGACATCAGAC
AGGAGTACCTGCGGCTGTTCGGCAAATCCCTCTACACTCA
CATCTCTGGTGACACTTCTGGAGATTATAAGAAGCTGCTG
CTGAAACTCTGCGGAGGAAGTGACTGAAGAGCAGGAGGAC
AGAGCCGTTTCCATGACGACTGGATATCTGACATCATATT
AATATCACTCATTTATCGATATGTCAGATGTGTCATGTTA
ACTGATCCTGTAATCACACCTTTATTAAGTTCACAACCAA
AATAGCATTTCATTTGTGCCTTAGACACGTACAGATAATA
ATATTGCAGTCTATATTTAGCCGTCTAACCTGACTATGCA
TGATATGTAGAGGATACAGCTGTCTTTTGTATTTGTGTGT
ACAGTACTGTCTTCAGATGCCAAAACCAAAACTGCAATCA
TCTCTTCTGTG

anxa11b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA anxa11b-201 (1)    Ensembl 2835
ncRNA anxa11b-002 771
anxa11b-003 (1)    Ensembl 117
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
anxa11b-002 Contained in:
[Fosmid] CH1073-74H19 (1), ZFOS-2177F3 (1)

Genome Resources: Vega_Trans:OTTDART00000050670 (1),  Ensembl_Trans:ENSDART00000149200 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DT080943 (1) 766 nt
CITATIONS (2)