header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-2601
Transcript Name: anxa11b-201
Previous Name: anxa11b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050669 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050669|OTTDARG00000035587|ZDB-GENE-030707-5 anxa11b|OTTDARP00000047845 anxa11b-001 LG_none CU611055.2,FP103002.4 Danio rerio protein_coding KNOWN, 2835 bp
GTGTGTGTGTGTGTTAGTAAATATCTGTGTTGTTTAAACC
CAGTTCAAATATGGACAACTCAACCATTAGGTTAAACATA
TAGAGTATACACAGAATATGTACAGGATATACGTGTACAG
ACCATAAGACAAACAGAAAGTGTGTGTGTGTGCGTGTGTG
TTGCGGATGTTGGCCACACCCACCGCCCTTTTACTTCCTC
ATTCACTCCAAACTCCCGATCTGCAATCTCACACATCACA
GTGTCGGAGATGAGTTACCCCGGTTATCCTCCAGCAGGTG
GCAGCTACCCGCCCGCATCCGGCCCATATCAGCAGCCGGC
AGCCGGGTACCCTCCTCAGCCTGGAGCGTATCCCCCACAG
GCCGGATACTACCCCCCGCAGCCCGGAGCCTTCCCCCCGC
AGCCCGGAGCCTTCCCCCCGCAGCCAGGAGCCTTCCCTCC
TGGAGCAGGATACCCTCCCCAGGCTGGCGGGTACCCAGCG
GCCCCGGGTGGAGGATTCCCCCCGCAGGCTGGAGGATACC
CCGCCGCTCAGCCCGGGGCATACCCTAACATGCCCGCTGC
AGGTGGATGGGGGGGCCATCCCGGCTTTGGAGCTCCAGCC
GGAGGCATGCCCCAGGGTTACCCAGGAGTCCCAGCACCAG
GACAGCAGCCCATGCCGGCATATCCTGGAGCTCCAGTCCC
GAACCCAGGCATGCCCGGGTATGGAGGAGGCGCCCCGACT
GGACCAACTCCACCCGCTCCTGCTATCAACAGGGGTTTTC
GTGGGACCATAAAGGATTTTCCTGGTGCGGATCCTCTTCG
AGATGTGGAGGTGTTGCGGAAAGCCATGAAGGGCTTCGGA
ACGGATGAAAACGCCATTATTGAGCTTCTGGGCAGTCGAA
GCAACAAGCAGCGTGTGCCTTTGCTGGCGGCGTATAAAAC
CACCTACGGAAAGGATCTGGTTCGTGACCTGAAGTCAGAG
CTGACGGGACACTTTGAGGAGTTGGTTCTGGCCATGCTTA
AATCTCCTGCACAGTTTGATGCATCTGAGTGCAAGGAAGC
CATATCAGGTGCAGGAACAGACGAGGCCTGTCTGATAGAG
ATCCTGTCCTCTCGCAGCAATGCAGAGATTCAGGAGATCA
ACAGAATCTATAAAGCAGAGTACGGTAAATCTCTGGAGGA
TGCCATCAGCAATGACACTTCTGGACATTTCCGCCGCCTG
CTCGTCTCTCTCTGCCAGGGTAATCGTGACGAGAGAGAGA
CTGTGGACATCTCTCTGGCCAAGCAGGATGCTCAGAAACT
CTACAGTGCTGGAGAGAATAAAGTGGGCACAGACGAGTCT
CAGTTCAATGCCATTCTCTGTGCCCGCAGTAAACCTCACC
TCAGACAGGTGTTTCAGGAGTACCAGCAGATGTGCGGTCG
GGACATCGAGAAGAGCATCTGCAGAGAGATGTCTGGAGAC
CTGGAGTCCGGCATGGTGGCAGTGGTGAAGTGCATTAAAA
ACACTCCTGCCTACTTTGCTGAACGCCTCCACAAGGCCAT
GCAGGGCGCAGGAACTAAAGACCGGACTCTGATCCGCATC
ATGGTTTCCCGCTCTGAGCTGGACATGCTGGACATCAGAC
AGGAGTACCTGCGGCTGTTCGGCAAATCCCTCTACACTCA
CATCTCTGGTGACACTTCTGGAGATTATAAGAAGCTGCTG
CTGAAACTCTGCGGAGGAAGTGACTGAAGAGCAGGAGGAC
AGAGCCGTTTCCATGACGACTGGATATCTGACATCATATT
AATATCACTCATTTATCGATATGTCAGATGTGTCATGTTA
ACTGATCCTGTAATCACACCTTTATTAAGTTCACAACCAA
AATAGCATTTCATTTGTGCCTTAGACACGTACAGATAATA
ATATTGCAGTCTATATTTAGCCGTCTAACCTGACTATGCA
TGATATGTAGAGGATACAGCTGTCTTTTGTATTTGTGTGT
ACAGTACTGTCTTCAGATGCCAAAACCAAAACTGCAATCA
TCTCTTCTGTGAAAATCATCGTTCAGATGCCTTGGAAATA
TTACACTTGAAGTTCTGAAATGTTTCTTTATGTAAAGTGA
GCTTTATATCTCTATGCAAGACACAAATATATATTGAATT
ATGACAATCTTTATGAAGGTCTACGTGTGTAAATCTCACA
GAAACGTCTCATAATTGACCCCAATATCAAGAGAAATCAA
GAAATACTTTGCTTATAAAATGTAAATCCTATTTTAGGAA
TGTTTTTGGTTATATTATAGTTTTTTCATATTACAATTAG
GCATTATTCATCCTTAATTTACATTAATGTATCTGGCTGT
TTAATTTGTGCATGATTTATTAGTGGTAATTCTTAATAAC
TTTGCTGGAAAAACATATATATTTTCTTCTTTTTATGCAA
CTTAAATTGTTTTTAATGTGCAAAAAAACTGTTTAAGTTG
CATAAAAAGAAGTAATGCATAACATGTAATGCATATTAAT
GGTCGTAAAACAGGCTTAATTTTCATGCATGTTTTATTAT
TAAATGTTTAATAATATTAATAATTCTTTGATTTGCTTTA
TTTGAGTCTGGGGTGAGCTATGAGCAGTTTCAGTGAGGTT
TGACCCTGATTATTATAGTGAATGTGCATCTCTGCAGCAG
TAGAGGGCAGTGTACAGTGAGCAATCTTTCCTCATGATAA
TCATCATCATCATCAGTAATTAAACAGGAGGTTCAGCCTG
TTCATCATCATGAAGACAGACAGCTCTAGTTTTCTAACAT
CTTCACTCTAACCTGTATTGTATAATAACTCGTGTCTGAT
TAATAAAGCACTCACAGCTCTTGCTTTAGTCTGCA

anxa11b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA anxa11b-002 (1) 771
anxa11b-003 (1) 117
mRNA anxa11b-201 2835
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
anxa11b-201 Contained in:

OTHER anxa11b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050669 (1)
  • Ensembl_Trans:ENSDART00000149089 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY178802 (1) 2627 bp
    GenBank:EE686469 (1) 917 bp
    GenBank:CD750790 (1) 843 bp
    GenBank:CN505278 (1) 769 bp
    GenBank:FP119844 (1) 739 bp
    CITATIONS (2)