header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-130528-368
Transcript Name: anxa11b-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058522 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058522|OTTDARG00000035587|ZDB-GENE-030707-5 anxa11b|no_translation anxa11b-003 LG_none CU611055.2,FP103002.4 Danio rerio protein_coding KNOWN, 117 bp
GCCACACCCACCGCCCTTTTACTTCCTCATTCACTCCAAA
CTCCCGATCTGCAATCTCACACATCACAACCTGAAACTCG
CCTACAGCACTTATTCATTGTTGCTCTTATAGTTGTG

anxa11b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA anxa11b-002 (1) 771
anxa11b-003 117
mRNA anxa11b-201 (1) 2835
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
anxa11b-003 Contained in:
OTHER anxa11b-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058522 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:FP184046 (1) 537bp
    GenBank:FP184151 (1) 353bp
    GenBank:FP184144 (1) 252bp
    CITATIONS (1)