ZFIN ID: ZDB-TSCRIPT-110325-669
Transcript Name: aatf-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes: aatf (1)
SEQUENCE
OTTDART00000050127 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050127|OTTDARG00000018669|ZDB-GENE-030131-9654 aatf|no_translation aatf-003 LG_ BX255908.4 Danio rerio protein_coding KNOWN, 687 bp
GGAAACCAGAGCCAGTTACTCCTGAAATAGACAACACCAT
CTCAGAGGGAGAGGTGGCTGAACTGGCAGTAAAAGCCAAC
ATGCACCTCAAAGATCTGGATGAGAACATTTTTGATGATG
ATGATTTTTATCATCAGCTTCTCCGAGAGCTTATTGAGCG
CAAAACAAGTGCAACAGACCCCAATGATCAAGTGGCCATG
GGAAAGCAATGGCTTGCTATCCAGAAACTGCGTAGTAAAA
TCAAGAAGAAGGTGGACACCAAAGCCAGCAAAGGCAGAAA
AATCAGGTTTCACGTTCACAGTAAGCTGATGAATTTTATG
GCTCCTATGGACAACAGCAGCATGAGCGATGATGCACGTG
ACAACACAATGACTGAAACATCTGTCCCAACATGCTTATA
CTCCGGGTGTGTGTGTACTACAGATGTCCACACACGCGCC
CATACTTATCTACTGCTCTTGCTGGTGAAATCCCTCAGGA
ACCCCAAACATATTTCCTTCTTTAAGTGACTTGCTGTAAA
TGAAACTAAAGAGTTATTGTGATTTGTGAGCTGACACATT
TTAGTGCCTCTTTATATTAAAAACATTGTCAACACACACA
CACACACAGAGTGTTTTCATTGATGTCCTAATTGTACTGT
TAGCACATGATTAAATCTAGTGAAAGCGATATCTACCTCT
AAATGAA

aatf TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA aatf-001 (1) 1969
aatf-002 (1) 654
ncRNA aatf-003 687
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
aatf-003 Contained in:
OTHER aatf-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050127 (1)
  • Ensembl_Trans:ENSDART00000150057 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH462138 (1) 732bp
    CITATIONS (2)