ZFIN ID: ZDB-TSCRIPT-110325-16
Transcript Name: aatf-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022714 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022714|OTTDARG00000018669|ZDB-GENE-030131-9654 aatf|OTTDARP00000018987 aatf-002 LG_ BX255908.4 Danio rerio protein_coding KNOWN, 654 bp
TAAGTTGCAGCGTGGGACAGACATGGCAGCTTCCATATCA
CAGCAGCTCGAGGATTTGTTAAATCCTTTACCACACTTCG
TGGACCCCGAGGACGACCAAGATGAAGACACCAAAGCGAA
AGTCATAGAGAAGTTTGATGAAGGAGGTGATGAGAACGAT
GAAGAGCTTTTACCTGGTCATCTGCGGAAACGCTCTGGGG
CCATTCTGGCTGATGGTGACCAACGATATCGTGGAAAGGC
AACATCCAGAAAAGACCTACAGAAAGATTTGGATGGATCA
GATGATGATGATAATGATGATGGTGTTGATGATGAAGATG
AAAGTGGAATGCTGGAAAAGTACATGGAATGCATGGATGA
TGATGATGATAATGATGATGATGATGATGATGATGATGAT
GATGATGATGATGATGTTGAGCATCAAAATGATGATGACG
AGGATCTCGTTGGAGATGATGGTTCACAGATGTCCAGCTT
GGTCTCCAAAATGAAGGGCACAGATTTTATGAAACTCACA
GAGGGATTGGATGACCTGGGAGACAGTGACGAAGATGAGG
AAACTGCTGACAGTGAAGAAGAGGAAGGAGAGAGTGATGA
AGGCTCCGAGGAGGAGATGGAAGAAGAGGAGGAATCAGGC
TTGAGGACCTTCTC

aatf TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA aatf-001 (1) 1969
aatf-002 654
ncRNA aatf-003 (1) 687
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
aatf-002 Contained in:
OTHER aatf-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000022714 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EE719454 (1) 943bp
    GenBank:BM860082 (1) 647bp
    GenBank:BM182769 (1) 591bp
    CITATIONS (1)