ZFIN ID: ZDB-TSCRIPT-110325-1824
Transcript Name: aatf-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022713 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022713|OTTDARG00000018669|ZDB-GENE-030131-9654 aatf|OTTDARP00000018986 aatf-001 LG_ BX255908.4 Danio rerio protein_coding KNOWN, 1969 bp
ATGTCACAGTAAGTTGCAGCGTGGGACAGACATGGCAGCT
TCCATATCACAGCAGCTCGAGGATTTGTTAAATCCTTTAC
CACACTTCGTGGACCCCGAGGACGACCAAGATGAAGACAC
CAAAGCGAAAGTCATAGAGAAGTTTGATGAAGGAGGTGAT
GAGAACGATGAAGAGCTTTTACCTGGTCATCTGCGGAAAC
GCTCTGGGGCCATTCTGGCTGATGGTGACCAACGATATCG
TGGAAAGGCAACATCCAGAAAAGACCTACAGAAAGATTTG
GATGGATCAGCAGATGAAGATGATGATGATAATGATGATG
GTGTTGATGATGAAGATGAAAGTGGAATGCTGGAAAAGTA
CATGGAATGCATGGATGATGATGATGATAATGATGATGAT
GATGATGATGATGATGATGATGATGATGATGATGTTGAGC
ATCAAAATGATGATGACGAGGATCTCGTTGGAGATGATGG
TTCACAGATGTCCAGCTTGGTCTCCAAAATGAAGGGCACA
GATTTTATGAAACTCACAGAGGGATTGGATGACCTGGGAG
ACAGTGACGAAGATGAGGAAACTGCTGACAGTGAAGAAGA
GGAAGGAGAGAGTGATGAAGGCTCCGAGGAGGAGATGGAA
GAAGAGGAGGAATCAGGCTTGAGGACCTTCTCAAAAGAGA
AAGTCGATGAAGAGGTTGAAAAAGGGAGAGCCGTGAAAAA
TCAGCTTGCCCTTTGGGACCTGATGCTTGAAAGGCGGATC
AAAATGCAGAAAGCTCTTGTGACAGCCAATCAACTTCCAC
AACCACAAACATTCTCAGAGTTCAAGAGCAGGGGAGGGGC
TGAATATGCTGATGCTTTGAAAAATAGTCATAAAGCTCTC
AAGGCTCTACAAAGGTCTCTGCTGGAACTTCAAGATCTGC
TGCTCCACCAAAACAAGGAAACAAGAGCCATCTCTCAGGG
CAAAACCTGGGGGGATGGCAGCAGTGCTAAAGATGATGAT
GAAGAGATTAATAGTGAAGATGATATGGATGAAAATGAAG
GTGATGACCAAGAGGTAGAACAGAAAGCAGCTCGAAACGG
ACCTCCCAAACGAAAACTGGAAATGGCAGATTATCCCAAC
TTTATGGCCAAACGCTTTGCTGCATTTCAACCGTATCGTG
ATACTACTCTCCAGAAATGGTATGACAAGACACGGCTAAC
AACGGGGAAGAACAATAAGGGTTTTGGAGCATTTGACAGG
AACATCCTGACGCAGGTGGAACAGGTTTTAATGGACAAAG
AGAGGCTGGTGAGGCGTACACAGACGCGCAGGTCTGAATA
CAGAGTCCTGGGGAAACCAGAGCCAGTTACTCCTGAAATA
GACAACACCATCTCAGAGGGAGAGGTGGCTGAACTGGCAG
TAAAAGCCAACATGCACCTCAAAGATCTGGATGAGAACAT
TTTTGATGATGATGATTTTTATCATCAGCTTCTCCGAGAG
CTTATTGAGCGCAAAACAAGTGCAACAGACCCCAATGATC
AAGTGGCCATGGGAAAGCAATGGCTTGCTATCCAGAAACT
GCGTAGTAAAATCAAGAAGAAGGTGGACACCAAAGCCAGC
AAAGGCAGAAAAATCAGGTTTCACGTTCACAGTAAGCTGA
TGAATTTTATGGCTCCTATGGACAACAGCAGCATGAGCGA
TGATGCACGGTCTGAGCTGTTTCGTTCCTTGTTTGCAAAT
GGTCCAGTGACAACACAATGACTGAAACATCTGTCCCAAC
ATGCTTATACTCCGGGTGTGTGTGTACTACAGATGTCCAC
ACACGCGCCCATACTTATCTACTGCTCTTGCTGGTGAAAT
CCCTCAGGAACCCCAAACATATTTCCTTCTTTAAGTGACT
TGCTGTAAATGAAACTAAAGAGTTATTGTGATTTGTGAGC
TGACACATTTTAGTGCCTCTTTATATTAAAAACATTGTCA
ACACACACA

aatf TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA aatf-001 1969
aatf-002 (1) 654
ncRNA aatf-003 (1) 687
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
aatf-001 Contained in:
OTHER aatf-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000022713 (1)
  • Ensembl_Trans:ENSDART00000028854 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC095857 (1) 1994bp
    GenBank:DT865932 (1) 865bp
    GenBank:DT882954 (1) 787bp
    GenBank:BI878967 (1) 762bp
    GenBank:DV594943 (1) 762bp
    GenBank:BM859862 (1) 652bp
    GenBank:DN898585 (1) 631bp
    GenBank:AI667272 (1) 559bp
    GenBank:BI850048 (1) 451bp
    GenBank:BM182422 (1) 385bp
    GenBank:BI876562 (1) 243bp
    CITATIONS (2)