ZFIN ID: ZDB-TSCRIPT-110325-595
Transcript Name: coch-201
Previous Name: coch-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049755 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049755|OTTDARG00000035016|ZDB-GENE-030616-403 coch|OTTDARP00000039032 coch-001 LG_ BX324186.12 Danio rerio protein_coding KNOWN, 2135 bp
AGACACCTCTGGAATATCATCCATAAGGGAATTACTTTAT
TTTTTGTGTATAAGCTTTTAAGGCTGAGGAAACGTCATCC
TACACAAAATCTAAATCTTCATTAACCATGTCGTTGTGGT
TTGCTGTCCTTCATGTTTTAGGTATTCTCTCTTTGAGCTG
GTGCACTTCTGGATCTGAATTAAATGTTGCAACGCCGATT
AGCTGTGGGACTCGTGCGGTGGATCTGTCAGACACACATC
TGCTGGTGCTCTGTCCAGCAAACTGCTCTCTGTGGAGCCT
CTCAGTGTTTGGTTCTGGAGTTTATGCCTCTATTTCCAGC
ATATGCGGAGCAGCCATTCACAGAGGAATCATAGGTCTGT
CTGGTGGACCAGTGGAGGTTCACGGACTGCAAGGGAGGAC
AAACTACCTCAGCTCTTACGCTCATGGTGTTCAGTCGCAG
TCACTGTCGCAATGGAGCGCATCGTTCACTGTGGCCCGAA
CAATTAGCTTGCCTTTGGAAGTGTCCAGCCAAACCAGCAG
TTCTGCCACCGTCGCATCTGGAGCAGCCAAGAAGCCAGTG
AAAAAAATAGTGAAGAAGCCTCCTCCAGCAACAGCACACA
AAGATTGTCCAGTTGATATGGCTTTGTTGCTGGATAGCAG
CTACAACATCGGACAGCGGCGGTTCAACTTGCAGAAGAAC
TTTGTCAGTAAACTTGCAACCATGCTGAAGGTTGGGACAC
AAGGTCCTCATGTAGGAGTGGTGCAAACCAGTGAAACACC
TCGAACTGAATTCTACCTGACAAACTATACGACAGCCAAA
GATGTGACCTTTGCCATCAAAGAAATCCCGTACATTGGGG
GCAATACCAATACAGGTAAGGCCATACTGCACACCGTGAG
GAACTTCTTCAGTCCGGATTTTGGGGTGCGGAGAGGTTAC
CCACGGGTGATTGTGGTGTTTGTTGATGGGTGGCCTTCTG
ATAATGTGGAGGAGGCAGCAATTTTAGCCAGAGAGTCTGG
CATTAACATCTTCTTTGTGTCTGTGGCCAAGCCTTCCCCT
GAGGAGGCAAGTCTGGTGAGCGATCAAGACTTCATGAGAA
AGGCAGTGTGCAAGGACAATGAGTTCTTCACCTTCACCAT
GCCCAGTTGGTTCAGCACCAACAAGTTTGTAAAGCCACTA
GCTCAAAAGCTTTGCTCCATCGATCAGATGCTTTGCAGCA
AGACGTGCTACAACTCAGTGGATCTGGGCTTCCTGATCGA
TGGCTCCAGCAGTGTAGGTGACGGGAACTTCCGGCTGGTG
CTGGACCTCCTTGTCTCTATCGCACGTAGCTTTGATATCT
CCGACATTGGATCTCGCATTGGTGCTATCCAGTTTACCTA
TGACCAAAGGATGGAGTTCAACTTCAATGACCATGTCTTG
AAAGATAATGCTCTAAGGGCCCTGCAGAAGATCCCATATA
TGAGCGGGGGAACAGCCACTGGAGATGCCATTAACTTTGC
TGTGCGGAGTCTCTTTAAACCCCGCTCAAGCTCCAACAGG
AAGTTTCTCATCATCATCACTGATGGACAATCTTACGATG
ATGTGAGAGTTCCAGCTATGGCTGCCCAAAGAGAGGGAAT
CACTGTTTACGCAGTGGGTGTTGCTTGGGCTCCTATGGAA
GATCTGAAGGCGATGGCGTCTGAGCCCAAGGAGAGCCATG
TGTTTTTCACTCGCGAGTTCACCGGGTTGGGACAGTTCCA
GCAGCCCATCGTCCGGGGCATTTGCAGGGACTTCACAGAG
TTCAATTAGACAATTTTGAGATTTTCTTGAGTGCAAGAAT
ATGAAGAAATTCAACAAAAAAAAAAAGGTGTCAGAGTAAA
TAAGAAAACCACGTTTGTCTTTAGATTTGTAGAAAAAGGG
ATTTGAACGGTTTTGATATAAAGGAATTGATATGTTTGAT
CCAAAGGTTTTTACAGCTTTTTTGAGAATGTATCACACAG
TATTGTATGTCAACTTCTCTATATGTGGAGAATGTAATTA
TTTGTGATTTGTAGTCTTTCTCTTTATGTTTCTGTTGAAA
AAAACCAACAACACATTCTTTCGCTGCTTCTGGCAAGCCT
TTTTTCCTGTGGAGGGGTCACTGTAACAAAAGGCTCTTTT
AGAATAATTTCAGAA

coch TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA coch-201 2135
ncRNA coch-002 (1)    Ensembl 815
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
coch-201 Contained in:
[BAC] DKEY-18B8 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000049755 (1),  Ensembl_Trans:ENSDART00000000948 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC162181 (1) 1745 nt
GenBank:BC162194 (1) 1745 nt
GenBank:EE712967 (1) 880 nt
GenBank:EH443909 (1) 872 nt
GenBank:EH447966 (1) 870 nt
GenBank:EH468311 (1) 746 nt
CITATIONS (2)