Transcript

coch-002

ID
ZDB-TSCRIPT-110325-1503
Name
coch-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000049756 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049756|OTTDARG00000035016|ZDB-GENE-030616-403 coch|no_translation coch-002 LG_ BX324186.12 Danio rerio protein_coding KNOWN, 815 bp
GACTCGTGCGGTGGATCTGTCAGACACACATCTGCTGGTG
CTCTGTCCAGCAAACTGCTCTCTGTGGAGCCTCTCAGTGT
TTGGTTCTGGAGTTTATGCCTCTATTTCCAGCATATGCGG
AGCAGCCATTCACAGAGGAATCATAGGTCTGTCTGGTGGA
CCAGTGGAGGTTCACGGACTGCAAGGGAGGACAAACTACC
TCAGCTCTTACGCTCATGGTGTTCAGTCGCAGTCACTGTC
GCAATGGAGCGCATCGTTCACTGTGGCCCGAACAATTAGC
TTGCCTTTGGAAGTGTCCAGCCAAACCAGCAGTTCTGCCA
CCGTCGCATCTGGAGCAGCCAAGAAGCCAGTGAAAAAAAT
AGTGAAGAAGCCTCCTCCAGCAACAGCACACAAAGATTGT
CCAGTTGATATGGCTTTGTTGCTGGATAGCAGCTACAACA
TCGGACAGCGGCGGTTCAACTTGCAGAAGAACTTTGTCAG
TAAACTTGCAACCATGCTGAAGGTTGGGACACAAGGTCCT
CATGTAGGAGTGGTGCAAACCAGTGAAACACCTCGAACTG
AATTCTACCTGACAAACTATACGACAGCCAAAGATGTGAC
CTTTGCCATCAAAGAAATCCCGTACATTGGGGGCAATACC
AATACAGGTTTAATAACTTCTCCTGAACTGCGTATTTCAT
ATGAACGAATGGGTTGAACACATGAAATATTTTTGTAAGT
AAATCATGCCACCCTTTAGAAGATGTAAACTGAACAAATG
TAATTTATAGTGATGCACTTAAAATAAAATCCAAATAAAT
GAAGTATACACATGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations