header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-589
Transcript Name: vrk1-201
Previous Name: vrk1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049730 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049730|OTTDARG00000035003|ZDB-GENE-040426-2709 vrk1|OTTDARP00000039011 vrk1-001 LG_none CU467823.11,CU929218.8 Danio rerio protein_coding KNOWN, 1542 bp
CATTCACGGTGCTTCACTCTGAACAGTCGTTTTGCGGGAA
GTTTGGAGAGCAGAGCGGTTGCAACTACTTACCGCTCACG
TGAGGAAAGTTTTTATAAATAAGGAAGATGCCACCAAAGA
AGGCAGACGGGGTGAAGAAAGCAAGAGCTCCAGCTAAGAG
GAAACTGGCTGAAGAATTCCCGTCTGGAGAAGTCCTGACA
GATAACGCAAAGAAAAAATGGAAGCTTGGATCAGCTGTTG
GACAAGGAGGTTTTGGCCTGCTGTATCTTGCAAATGAAGA
CTCTTCAGGACCTGTCACCGCTGATGCACCTTATGTCATT
AAAGTGGAACCAAGTGACAACGGCCCTCTCTTCTCTGAAC
TGAAGTTCTACATGCGAGCTGCCAAACCTGATCTAATCGG
GGCTTGGATGAAGTCAAAGAAAATGGAGTATTTGGGAGTT
CCAAAATATTGGGGTTCTGGTTTTCATGAGAAAAATGGAA
AGAGGTACAGATTTATGGTGATGGATCGATTTGGAACAGA
TCTACAGAAATTGTTTGAAGGAAATGGGAAGAAGTTTTCA
AGGAAGCTGGTTCTTCAGCTGGGCCTTCGACTTCTTGACA
TTCTGGAGTACATCCATGACCATGAATATGTGCATGCAGA
CATCAAAGCCTCCAACCTCCTCCTGTCCTACACCAACCCC
AATCAGGTATTTTTAGTAGATTATGGACTGGCCTATAGAT
ATGCTCCTGAGGGAGTGCCAAAGGAGTATAAGGAAGACCC
AAAGAGGTGTCATGACGGTACCATTGAGTTCACAAGTATT
GACGCACACAAAGGAGTCTCTCCTTCAAGGCGAGCAGACC
TGGAAATCATGGGCTACTGCATGATCCAGTGGTTATGTAG
CCGTCTGCCCTGGGAAGACAAACTTCAGGACCCACTCTAC
GTCAGAGACTCCAAGCTCAGGTGTAGAGACAATATTGATG
AGTTCTTGAAAAGCTGTTTCGCTTCAGGAAATATACCAGC
TGAAATGGGAAAGTTCATGCAAGAGGTCAAGGTTCTGGGA
TACACAGACAGGCCAGATTACGACAAATTGCGAGGTATTT
TGCAGCAAGGCCTAAAGTCCATAGGGTCAACAGATGACAA
AAAGCTGGACTTCGGAGTGGCGACCAACAGCACAAGTTTG
CCCTCTGTCAAGACTCCCAAGCGAAAGAAAGCAGAGGAAA
AAGGCCAGTCTGCTGACGAAACCGATAGCACCCCAGCAAA
GAAGAGGCGAGCTCCTCAGAAGAAGGAAGTGAATGGGGCT
AAAAAGACAGCAAGTCCTGCAAAGCGTCCAGTGAAGAAAG
AAGCTCAGGCCTCCTCTGAGCCAGCGGTGAAGAAAAGCCG
AGGAAGGCCTAAGAAGAACTCTTAATCCTTTTTGCACTCC
AGTTCAAGTCGTTTTCTTTTTGTATCTTTTAAATTGTCTG
GTCTGTATTTGTTCTCTGTGGTTGAATTTTCTTAAACTTT
AGCAGGGTGTTGGGCACACTCTCGCAGTGAAATGATAATA
AATATGGGGTAAAGAAAAAAAA

vrk1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA vrk1-002 (1) 448
mRNA vrk1-201 1542
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
vrk1-201 Contained in:
[Fosmid] CH1073-432E22 (1) (order this)

OTHER vrk1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049730 (1)
  • Ensembl_Trans:ENSDART00000045991 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC047853 (1) 1562bp
    GenBank:BC152280 (1) 1517bp
    GenBank:EH564873 (1) 938bp
    GenBank:DV593356 (1) 763bp
    GenBank:CT681676 (1) 670bp
    CITATIONS (2)