header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-120702-170
Transcript Name: vrk1-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055378 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055378|OTTDARG00000035003|ZDB-GENE-040426-2709 vrk1|no_translation vrk1-002 LG_none CU467823.11,CU929218.8 Danio rerio protein_coding KNOWN, 448 bp
TGCTCTAGGCAAGTGCATTGACCACTGCTCTTCCATCTTT
TCCATCCCTGTGTTTGTGTCTTTATTTTTGACTGGAAGAC
TCCCAAGCGAAAGAAAGCAGAGGAAAAAGGCCAGTCTGCT
GACGAAACCGATAGCACCCCAGCAAAGAAGAGGCGAGCTC
CTCAGAAGAAGGAAGTGAATGGGGCTAAAAAGACAGCAAG
TCCTGCAAAGCGTCCAGTGAAGAAAGAAGCTCAGGCCTCC
TCTGAGCCAGCGGTGAAGAAAAGCCGAGGAAGGCCTAAGA
AGAACTCTTAATCCTTTTTGCACTCCAGTTCAAGTCGTTT
TCTTTTTGTATCTTTTAAATTGTCTGGTCTGTATTTGTTC
TCTGTGGTTGAATTTTCTTAAACTTTAGCAGGGTGTTGGG
CACACTCTCGCAGTGAAATGATAATAAATATGGGGTAAAG
AAAAAAAA

vrk1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA vrk1-002 448
mRNA vrk1-201 (1) 1542
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
vrk1-002 Contained in:
[Fosmid] CH1073-432E22 (1) (order this)
OTHER vrk1-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000055378 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AI626472 (1) 451bp
    CITATIONS (1)