Transcript

bin1b-202

ID
ZDB-TSCRIPT-110325-371
Name
bin1b-202
Previous Names
  • bin1-004
  • bin1b-004
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048981 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048981|OTTDARG00000034595|ZDB-GENE-030425-1 bin1b|OTTDARP00000038436 bin1-004 LG_none CU659670.13,CU655960.18 Danio rerio protein_coding KNOWN, 867 bp
GCTGGTGGACTTTGACAGTGCCAGACATCATTTTGCCTCT
GTACAAAAAGGCAAGAAAAAGGACGAGGCCAAAATTGCAA
AGGCTGAGGAAGACTTGGGCAGAGCTCAGAAAGTGTTTGA
GGAGATCAATTATGATCTCCAGGAGGAACTTCCCACCCTG
TGGAACAGTCGTGTTGGCCTCTATGTTAACACATTCCGGA
GTGTGTCTGGCCTGGAGGAAACATTTCACAGGGACATGGG
CAAACTGAACCAGAATCTGAGTGATATTATGACCAAACTG
GAAGAGCAGCGTGTTGCCAATGACGATGCAGCAAACCACA
ATCAGGAGACGTCAGATGCACCTAAATCTCCATCAAAGCT
CAGAGACGTACCGCCGGTCTCTCGACCGCCCAGACCAGCT
TCATCTCAGGAGGTGAAACCGGACAAGATCATTAACCTGT
TTGAGGATGCAGAAGTGTCTGACAGTAACACCACAACACA
ACCTGAGCAGAATGAAGCCCCAACGGTGACAAATGGCTCC
TCAGATACAGAGCTTCCTCCATCTGTTCTCTTTAAGGTGA
AAACAATGCACGACTACAGTGCAACAGACAGTGATGAACT
TGACCTGAAGGCTGGTGACATTGTGCTTGTGCTTCCCTTT
GCCAACCCAGATGAAGCGGATGATGGCTGGTTAATGGGTG
TAAAAGAGTCCCACTGGCTTCAGAACAAAAACCTCCTAGC
AAAAGGAGTCTTCCCTGAAAACTTCACCCAGAAACTGTGA
GCGGAGTCGCTTTCTCACAACCACCTGTTCTCATCCTTCA
TTTTCTCACTTCTACTCTACTGTGATAACGATTTTTTTAT
AAAACATCTTGAAAAATAATGGCTACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations