Transcript

bin1b-203

ID
ZDB-TSCRIPT-110325-1279
Name
bin1b-203
Previous Names
  • bin1-003
  • bin1b-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048982 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048982|OTTDARG00000034595|ZDB-GENE-030425-1 bin1b|OTTDARP00000038437 bin1-003 LG_none CU659670.13,CU655960.18 Danio rerio protein_coding KNOWN, 756 bp
CTGTTGATCCGACAGACAGTGTATTTCCCCATACATTACT
GCTCCTCAGCACCTCCCGCCTCTCTCTCTGCGCTTTACTT
CATTCATAACCATTTATTTATTTTTATATTTATTCACTTT
GGAGACTTGAAGTAGCTCAAAAGATGGCAGAGGTTGGGAA
AGGAGTCAACGCCGGGAAACTGGCCAGTAATGTACAGAAG
AGGTTAACCCGAGCACAAGAGAAGGTGATGCAGAAACTGG
GAAAGGCGGATGAAACCAAAGACACAGCCTTTGAGGAGCA
AGTAGCCAACTTTAACAAACAGATGAACGAGGGCACCAAA
CTGCAGAAAGACTTGAAAGCGTATTTGCTGGCAGTCAAAA
CAATGCACGAGTGTTCCAAGCGTCTGCACGACTGTCTGGC
AGAAATGTATGACCCTGAGTGGTTTGGCAAAGAGGAGGTG
GACTCCATCGCAGAGGACACTGACCTCCTGTGGCAAGATT
TCCACGAGAAGCTTTTGGACAATGCTGTAATTTCCATGGA
CGCATACTTGGCTCAGTTTCCAGATATAAAGGCTCGCATT
GCAAAGCGTGAAAGGAAGCTGGTGGACTTTGACAGTGCCA
GACATCATTTTGCCTCTGTACAAAAAGGCAAGAAAAAGGA
CGAGGCCAAAATTGCAAAGCCTCTGGCTCTGGTGGAAAAG
GCTGCTCCTGTTTGGGCTCAGGGAATATTAACAGCACATC
AGATCGCTCAAACTAACCTCACACGAAACCAGGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations