Transcript

cxcr4a-201

ID
ZDB-TSCRIPT-110325-361
Name
cxcr4a-201
Previous Names
  • cxcr4a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048942 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048942|OTTDARG00000034570|ZDB-GENE-020102-1 cxcr4a|OTTDARP00000038406 cxcr4a-001 LG_ CU639412.12 Danio rerio protein_coding KNOWN, 1636 bp
CAGCTACCTGCGAGCGCAGACTCGTGAGCGCGTGCTGTGC
AGTTGACGTGAGTAAAATAGAGGCGGGGCTTCCGCGCGAG
AGAGGTATTTAAACTGTTCGAGCGCCACAACATTTAGAAA
AATACTGAAGACTTGCTGGAGACTGAAGGAGCTGGAGAAG
TCTTTTAGAGATGGCTTATTACGAACACATCGTCTTTGAA
GATGATTTATCAGCTGATAACAGCTCTGAATTCGGCTCGG
GGGACATCGGAGCCAACTTTGAGGTCCCGTGTGATGTGGA
GGTCAGTCACGACTTCCAGAGGATCTTTCTCCCAACGGTG
TACGGGATCATATTTGTTTTGGGTCTTATCGGGAACGGAC
TGGTTGTTCTGGTAATGGGTTGCCAGAAGAAATCCAGAAC
CATGACAGACAAGTACCGTCTGCACCTCTCAGTGGCGGAC
CTTCTGTTTGTGCTCACTCTGCCATTCTGGGCTGTGGACG
CGGCCAAAGACTGGTACTTTGGAGGGTTCATGTGCGTGGC
CGTGCATATGATTTACACGGTAAACTTGTACAGCAGCGTC
CTCATCCTCGCCTTCATCAGTTTGGACCGGTACCTCGCTG
TAGTGCGCGCCACAAACAGCCAGGGTCCGAGGAAACTTCT
GGCCAACCGCATCATTTACGTGGGCGTGTGGCTCCCCGCC
GCGCTCCTCACTGTGCCCGACCTGGTGTTCGCCAAAGCGG
AGAGCAGCGCCATCCGTACCTTCTGCGAGCGCATATACCC
GCAGGACTCGTTTGTCACATGGGTGGTCGCCTTCCGCTTC
CAGCACATCCTCGTGGGCTTCGTGCTTCCCGGGCTCGTGA
TCCTCATCTGCTACTGCATCATCATCTCCAAGCTGTCGCG
CGGCTCCAAAGGCACGCAGAAGCGCAAGGCGCTGAAGACC
ACCGTGGTTCTGATCGTCTGCTTTTTCGTCTGCTGGTTGC
CGTATTGCGGAGGGATCCTGCTGGACACGCTGATGATGCT
GGAGGTGATTCCCCACAGCTGCGAGCTGGAGCAGGGGCTG
CAGAAATGGATCTTCGTGACGGAGGCGCTCGCGTACTTTC
ACTGCTGTCTCAACCCGATCCTGTACGCCTTTCTGGGGGT
GAAGTTCAAGAAGTCCGCTCGCAGCGCTCTGTCTCCCAGC
CGGGGGTCCAGTCTTAAAATTCTGTCCAAGAAGAGGACAG
GAATGTCATCCGTGTCCACAGAATCTGAATCTTCCAGCTT
TCACTCTAGTTAACGCAAGAGCGCGCACCTTGGACTATGA
ACATGCTTTCAGATTTAATGTCATGAAATTACCAGATATA
AAAATGAGCAAACAGGCTGAGCCTAATTGAAAAGTTGTAA
ATATGTTCATAAGAATGTTGACAAATACTGCAATGCTTCC
AGTATTACTCTTCACATTGAGACTTTGTGAGGAAAAATGT
GTTTATATATTGTGCACAATGTTTACTGTACATATCATGT
GTGTATATAGATTTTTTTACTTAGTTCTTTTCTGCACTTA
TGTAGACCATTGCATTTATTTATTATGTGATAAACCAAAG
ATGGATTGAATTATCCATTCCAAGAGCTGCTTTGTCAATT
TGAAGTCTTTACAATAAATTGTTTTGAATACTCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations