Transcript

cxcr4a-202

ID
ZDB-TSCRIPT-110325-1269
Name
cxcr4a-202
Previous Names
  • cxcr4a-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048943 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048943|OTTDARG00000034570|ZDB-GENE-020102-1 cxcr4a|OTTDARP00000038407 cxcr4a-002 LG_ CU639412.12 Danio rerio protein_coding KNOWN, 1227 bp
GAAAAATACTGAAGACTTGCTGGAGACTGAAGGAGCTGGA
GAAGTCTTTTAGAGATGGCTTATTACGAAGTAAGTTATAA
TGCCTATTTAAACATTGTCTGTAATTATTAAATAGCATAC
ATTTAAATTAATTATTTCCAACTTTGTTAACTTTTTCAGC
ACATCGTCTTTGAAGATGATTTATCAGCTGATAACAGCTC
TGAATTCGGCTCGGGGGACATCGGAGCCAACTTTGAGGTC
CCGTGTGATGTGGAGGTCAGTCACGACTTCCAGAGGATCT
TTCTCCCAACGGTGTACGGGATCATATTTGTTTTGGGTCT
TATCGGGAACGGACTGGTTGTTCTGGTAATGGGTTGCCAG
AAGAAATCCAGAACCATGACAGACAAGTACCGTCTGCACC
TCTCAGTGGCGGACCTTCTGTTTGTGCTCACTCTGCCATT
CTGGGCTGTGGACGCGGCCAAAGACTGGTACTTTGGAGGG
TTCATGTGCGTGGCCGTGCATATGATTTACACGGTAAACT
TGTACAGCAGCGTCCTCATCCTCGCCTTCATCAGTTTGGA
CCGGTACCTCGCTGTAGTGCGCGCCACAAACAGCCAGGGT
CCGAGGAAACTTCTGGCCAACCGCATCATTTACGTGGGCG
TGTGGCTCCCCGCCGCGCTCCTCACTGTGCCCGACCTGGT
GTTCGCCAAAGCGGAGAGCAGCGCCATCCGTACCTTCTGC
GAGCGCATATACCCGCAGGACTCGTTTGTCACATGGGTGG
TCGCCTTCCGCTTCCAGCACATCCTCGTGGGCTTCGTGCT
TCCCGGGCTCGTGATCCTCATCTGCTACTGCATCATCATC
TCCAAGCTGTCGCGCGGCTCCAAAGGCACGCAGAAGCGCA
AGGCGCTGAAGACCACCGTGGTTCTGATCGTCTGCTTTTT
CGTCTGCTGGTTGCCGTATTGCGGAGGGATCCTGCTGGAC
ACGCTGATGATGCTGGAGGTGATTCCCCACAGCTGCGAGC
TGGAGCAGGGGCTGCAGAAATGGATCTTCGTGACGGAGGC
GCTCGCGTACTTTCACTGCTGTCTCAACCCGATCCTGTAC
GCCTTTCTGGGGGTGAAGTTCAAGAAGTCCGCTCGCAGCG
CTCTGTCTCCCAGCCGGGGGTCCAGTCTTAAAATTCTGTC
CAAGAAGAGGACAGGAATGTCATCCGTGTCCACAGAATCT
GAATCTTCCAGCTTTCACTCTAGTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations