header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-2541
Transcript Name: bmp15-202
Previous Name: bmp15-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050362 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050362|OTTDARG00000035391|ZDB-GENE-030131-6115 bmp15|OTTDARP00000039528 bmp15-002 LG_none CU633476.8,BX957362.26 Danio rerio protein_coding NOVEL, 640 bp
GTACAAATGCTGAGTTTATATGAGTAAGTAGCAGGAATTG
AATCACCATTTAAAAGTGTAAATGAAGGGCCTTGTGCCTC
TATAGCCCCTTAAAACTTAGAACGTGGACGTTTGGCATGT
GGTGTGACATAAGTGGCCGTTTCTCATCCAGAAAAACTTA
AAAGTGAACTAAAACTAATATATTAATTTTCTTTTCATCA
TAAGCTCTGGTTTGCCCTCCAAACGCGGTACAAAAGGACA
CACACTGCCATGATTTCTTCGCGGAAATTCCCGGAAGCAA
CGGGCCCAATCAGAAAGCACAACCTGCTTGTTTTACCCAA
TGAGCGCACTCGAAACCTGCATGTACGGATAGCGGCGGAT
GCAGATGGACGACCAAAGCAGCACAAGATTTTTGGGTCCA
ACACCATAAGACTGCTTCAAGCATCAACCACTGAAAAACA
CTTTCTCCCAACATCAAGTGATCTTCAGTACACCTACACA
GTGAAATATGAACTGAATGACCTCTTGTTGGACAAACTGG
TGAAGGCGTCTTTCATGCACCTGAGGTCTCCCATGTCATC
ACGTCTTCCTTACATCTGTGAGGCGAGTGTCACGTCTCTT
CAAAATCCTCTTGAGGGTGACCGGATCACTATGGGCCCCC

bmp15 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA bmp15-201 (1) 2001
bmp15-202 640
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
bmp15-202 Contained in:
OTHER bmp15-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050362 (1)
  • Ensembl_Trans:ENSDART00000149793 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BM958313 (1) 639bp
    CITATIONS (2)