header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-1633
Transcript Name: bmp15-201
Previous Name: bmp15-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050361 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050361|OTTDARG00000035391|ZDB-GENE-030131-6115 bmp15|OTTDARP00000039527 bmp15-001 LG_none CU633476.8,BX957362.26 Danio rerio protein_coding NOVEL, 2001 bp
GGCCTTTGACGTTTGACGGATAATTGGACATGACGTCACA
CGATTAGAGGCGCACCAGAAAGTTTGTGGCCGTCAGCTGA
TGTTCAGGTTGAATTCCGCCCGCTGATTGTCTTAGACGAT
GGTAGCCTTTCAGGTGGCACTCGTGCGTACGAGGGGCTGA
ACATGAAGGCTACCAGCGGCCCCAACGGTCTGAGACTCTG
CGTACTGTCCTGTTTGTTTGTGCTGCACATATTCACGCGC
GTGGCCGGAAACATGGCCTCCCCGTCACATTTTGGCGTCG
CCAGTACAGAAGTTCACCAAAATCGACACCCAAAAAGGAG
AAACCCTCATTTTAGACCTCCCGTAGAAAGCCGAACTGAC
GATGATGGCATGCGACTGATGTTGAGTCTATACAGGATAG
CGGCGGATGCAGATGGACGACCAAAGCAGCACAAGATTTT
TGGGTCCAACACCATAAGACTGCTTCAAGCATCAACCACT
GAAAAACACTTTCTCCCAACATCAAGTGATCTTCAGTACA
CCTACACAGTGAAATATGAACTGAATGACCTCTTGTTGGA
CAAACTGGTGAAGGCGTCTTTCATGCACCTGAGGTCTCCC
ATGTCATCACGTCTTCCTTACATCTGTGAGGCGAGTGTCA
CGTCTCTTCAAAATCCTCTTGAGGGTGACCGGATCACTAT
GGGCCCCCGAAGCCGGTGGACAGAGACCGACGTCACAGAC
CATGTGTCCGAGTCAAAAGATGGCCACGTATCTTTCTTTG
CTCGTTATTGGTGCACAAAGCCGGAGCACAAAAGATCTGT
TGCACATCGGAAGCGCTTCCCACCTCAACACCATCTTCGT
GCTCCTCTTCTGCTGCTCTTCTTGGAGGAGAACAAGCACC
CGGTGGAGTGGGGGAAGAGCTTCCCGCCACTCTCCCGTCC
CAGGACCCGTCGGTCTAAAAAGTCTGGCAGCATCGTCTCT
GATATCCCAAACTTCAAGCAGGGGCTGAACCGAGTGACCA
AAAACAACTGCAAGCTGTACTCCTCCAGCGTGGACTTCAA
AGATTTGGGGTGGGACCACTGGGTCATTGCACCCCACAAG
TACAATCCTGGATACTGCATGGGAGATTGTCCTCGCATCC
TGCATTACGGCTACAATTCGCCCAACCACGCCATCATGCA
GACGTTCATCAGCGAGCTGGGTGTAGCGGATATCCCGTTG
CCCTCCTGCGTTCCTTATAAATACAAACGTATGAGCATGC
TAGTGATGGGGAGTAATGGACAAATAGATTATAAAGAATA
CGAGGACATGATTGCAGACTCCTGCACCTGCAGATGACTT
TGGGCTTGTGGTAAGAATGGAAAAGACCTGATTGGTGCTT
AAGGGCAGTCTTGCCGACACAATTGAGGAACTAAACCAAA
AGAAATGGGCATGCCAGGTTGGATTTGCCTGTTGCTCCAC
TTCTTGTGCATAACTAACACCATCTCTTGCATACAGACTT
TCTGGGGATGTAGGTATGAATAAGGTGAATGAGCTATTCT
GTATATGTACATGTTTTTCTTTTCTGTTTACTCGTTGTAT
GTGTATGTTATTTGATCTAGTGTGTGTGTGTCCTGCATTT
AGTGTGTATTAATGTGACATCTTTCATAATGTATTTATGG
AGAGGGAGCAAAGTTGGAGAATTTTGGCACTTTATTAACA
CTGGACTGGAAAAAAAAAAAAGAAAATGGAGGAGAAAAAA
AATGATGAAGCACAAAAGGGCCCTGTCTGTTGACTTTTGG
CCATTATAGCTCGTGTCTGCTGGATTTCTGAAAGCACAGA
CCGAAAGCAATGAGAGAAAAGGAGCAGATGCTGTTTTTGC
ATTACCTCAATGAAAACCATGCAGTAAGTGTATGAAAGAG
ACTGTCGTAGATGTGTTTCTCAGTAGTGAGGAATGCAAGT
CCATGCACCCGAATTGATGTTTTAATGTCACGATGAAAGA
CAATGAAATAAAATATGTATTTTGTAAAAAAAAAAATGAA
A

bmp15 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA bmp15-201 2001
bmp15-202 (1) 640
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
bmp15-201 Contained in:

OTHER bmp15-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050361 (1)
  • Ensembl_Trans:ENSDART00000054591 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC115085 (1) 1872 bp
    GenBank:BC124106 (1) 1683 bp
    GenBank:EG574886 (1) 949 bp
    GenBank:EE300006 (1) 883 bp
    GenBank:BM265715 (1) 667 bp
    CITATIONS (2)