header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-2495
Transcript Name: ccnb1-201
Previous Name: ccnb1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050165 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050165|OTTDARG00000035277|ZDB-GENE-000406-10 ccnb1|OTTDARP00000039372 ccnb1-001 LG_ BX571667.5 Danio rerio protein_coding KNOWN, 1901 bp
TTTTCGAACCCAGCGAATCATATTTGAAAGAGCGACAATT
TAAACCTCTGTAGAGAAATAGTGCTATATTGAGCTCGCTT
GAGTAGATTTTACCAGTTTGTTCATCGAGTCACAGCAATA
AACCACGAGAAATAATGGCTCTCCGTGTCACAAGGAACAC
TCGCCTGGCCAGCAGCGAGAATCAGAACGCTCTGCCCGGA
AAAGCAGTTGTAGCGAACAAGCCCGGACTCAGACCAAGGG
CCGCGCTGGGGGAGATTGGCAACAATCCGCAAACACGACA
GGCTTTGAAGAAGAAGGAGGTGAAGGTTGCACCCGCCGCC
GAGGTTGTGGTTGAGAAGGCACCTGTGGTTCAACAGCCCA
AGAAGGATTCTCCTAAGGTTCAACATGGCGTTAAGGTTGT
GTCTGAGCCTTCCTCTCCTGTTCCTATGGAGACCTCCGGC
TGTGCTTCAGATGATCTGTGTCAAGCATTCTCTGATGTTC
TGCTTAATATCAAGGATGTTGACGCAGATGACTATGATAA
TCCCATGCTTTGCAGTGAATATGTCAAGGACATCTATTTG
TATTTGCGCCAGCTTGAGACTGAACAAGCTGTAAGGCCAA
AATATCTGGCAGGAAAGGAAGTTACTGGGAACATGCGTGC
CATTCTTATCGACTGGCTTGTACAAGTCCAGATTAAGTTT
AGGCTGCTTCAGGAGACAATGTACATGACTGTTGCCATCA
TTGATCGCTTCCTTCAGGATCATCCAGTTCCAAAGAAGCA
GCTGCAACTTGTTGGTGTAACGGCCATGTTCATCGCCTCA
AAATATGAAGAGATGTACCCACCAGAGATTGCAGACTTTG
CTTTTGTGACAGACCGTGCATACACCACCAGTCAAATCCG
GGAGATGGAGATGAAGGTCCTAAGAGTCCTCAACTTTGGT
TTTGGAAGGCCTCTACCGCTACAGTTTCTCAGGAGGGCCT
CCAAGATTGGAGATGTGACTGCAGAACATCACACATTAGC
GAAATATTTCCTGGAGCTCACCATGGTCGATTATGACATG
GTCCACTACCCTCCCTCTCAGATGGCCAGTGCTGCTTATG
CCCTGACCCTGAAGGTCTTCAACTGTGGTGACTGGACCCC
TACTCTTCAGCACTACATGGGCTACACTGAAGATGAGCTG
GTTCCTGTGATGCAGCATATTGCCAAAAATGTTGTGAGGG
TCAACGAGGGCCTTTCTAAGCATCTGGCTGTGAAGAATAA
GTACTCCAGTCAGAAGCAGATGAGAATTGCTACAATTTCT
CAGCTCAAGTCCTCCTTGATCAAAGACCTGGCTAAGCAGA
TCTCATAGTTGGGGTTATGCTGAAGAGACTTAAGCACTGT
GTGCTGCCTTGTAAAAATTGTAACTTATGCATGTTTTACT
GTTGAACCTTTTTATTGCAATTTATTTTACGGATTTCTTC
ACTGCCATGGGTTGAGCAAAAGTAATCTTTTAATGATTCA
AAGTGTTTTTGCAAGTTTGTACATTTGAATTCAAATAAAC
TTTTTAAAGTTTTAAGCTTCAGCGTACTTGTAAGTTTTGT
ATGAACATTTTAGCTTTAGGGCTAGGATGGTATGGAATCA
AGTCACTATCACCATTGAGCGGGTTACTGAATACAAGGAC
TATTTCTGCTAGTTTTAGTTAAACTGACTTGGTTTTGTTT
TTTGCTTGGGTTTAGTCAAAGTGCTGCTTTATGAACGCAT
GATTTAAACCACATTTTGTTATTGGACCAATTAAACTAAT
GGTTTTGATAATGTGCCACTGCAATGGATTGTCAATTTTG
AATATATTTGTTATGTAAGTTTAGTGTGTGTGTGTGTGTA
GCGAGGAAATATTTTGTAAATAAGAATTTTATTTGTTTTG
GCTATTAAAAATGTAAAGCTA

ccnb1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ccnb1-005 (1) 876
mRNA ccnb1-201 1901
ccnb1-202 (1) 559
ccnb1-204 (1) 658
ccnb1-205 (1) 770
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ccnb1-201 Contained in:
OTHER ccnb1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050165 (1)
  • Ensembl_Trans:ENSDART00000063357 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC045492 (1) 1893bp
    GenBank:AB040435 (1) 1519bp
    GenBank:BC067192 (1) 1515bp
    GenBank:EH519225 (1) 976bp
    GenBank:EH504187 (1) 955bp
    GenBank:CN016000 (1) 782bp
    CITATIONS (2)