header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-681
Transcript Name: ccnb1-205
Previous Name: ccnb1-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050169 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050169|OTTDARG00000035277|ZDB-GENE-000406-10 ccnb1|OTTDARP00000039375 ccnb1-003 LG_ BX571667.5 Danio rerio protein_coding KNOWN, 770 bp
CGATGTCTAACATGGTGCTGTGTTAGCGCGTTCTTCAGTT
CCTATAATTTGCGAAAGCATTTTGTAGAAAGTTTCATTTT
AGAGATCGTGTTTTATTTGTCACTGTTGCATTTTAACTTT
TTTTTAATGTGCTGTTTATAAGACTATTAATCGCATGCTT
TAAGTTTACGATGAACTATATTGCATGATGTCTATAGATT
TTAGTTGAAAGCTCTCTAACCTAACTGTTTAAGCCACCAC
TTACCATTTCTGTAAAACTGATTATTTTATCCACCCTACC
GAGTAGAACACTCGCCTGGCCAGCAGCGAGAATCAGAACG
CTCTGCCCGGAAAAGCAGTTGTAGCGAACAAGCCCGGACT
CAGACCAAGGGCCGCGCTGGGGGAGATTGGCAACAATCCG
CAAACACGACAGGCTTTGAAGAAGAAGGAGGTGAAGGTTG
CACCCGCCGCCGAGGTTGTGGTTGAGAAGGCACCTGTGGT
TCAACAGCCCAAGAAGGATTCTCCTAAGGTTCAACATGGC
GTTAAGGTTGTGTCTGAGCCTTCCTCTCCTGTTCCTATGG
AGACCTCCGGCTGTGCTTCAGATGATCTGTGTCAAGCATT
CTCTGATGTTCTGCTTAATATCAAGGATGTTGACGCAGAT
GACTATGATAATCCCATGCTTTGCAGTGAATATGTCAAGG
ACATCTATTTGTATTTGCGCCAGCTTGAGACTGAACAAGC
TGTAAGGCCAAAATATCTGGCAGGAAAGGAAGTTACTGGG
AACATGCGTG

ccnb1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ccnb1-005 (1) 876
mRNA ccnb1-201 (1) 1901
ccnb1-202 (1) 559
ccnb1-204 (1) 658
ccnb1-205 770
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ccnb1-205 Contained in:
OTHER ccnb1-205 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050169 (1)
  • Ensembl_Trans:ENSDART00000150138 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN178727 (1) 934bp
    GenBank:DN599547 (1) 777bp
    CITATIONS (2)