header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-2496
Transcript Name: ccnb1-204
Previous Name: ccnb1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050168 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050168|OTTDARG00000035277|ZDB-GENE-000406-10 ccnb1|OTTDARP00000039374 ccnb1-002 LG_ BX571667.5 Danio rerio protein_coding KNOWN, 658 bp
ATGTTGCGTTGTACAGAGCAGCCTTTGTTCATTATTCATC
TGAAGGAGAATGCCAGAGATGTTCCATTATCGATGTCTAA
CATGAACACTCGCCTGGCCAGCAGCGAGAATCAGAACGCT
CTGCCCGGAAAAGCAGTTGTAGCGAACAAGCCCGGACTCA
GACCAAGGGCCGCGCTGGGGGAGATTGGCAACAATCCGCA
AACACGACAGGCTTTGAAGAAGAAGGAGGTGAAGGTTGCA
CCCGCCGCCGAGGTTGTGGTTGAGAAGGCACCTGTGGTTC
AACAGCCCAAGAAGGATTCTCCTAAGGTTCAACATGGCGT
TAAGGTTGTGTCTGAGCCTTCCTCTCCTGTTCCTATGGAG
ACCTCCGGCTGTGCTTCAGATGATCTGTGTCAAGCATTCT
CTGATGTTCTGCTTAATATCAAGGATGTTGACGCAGATGA
CTATGATAATCCCATGCTTTGCAGTGAATATGTCAAGGAC
ATCTATTTGTATTTGCGCCAGCTTGAGACTGAACAAGCTG
TAAGGCCAAAATATCTGGCAGGAAAGGAAGTTACTGGGAA
CATGCGTGCCATTCTTATCGACTGGCTTGTACAAGTCCAG
ATTAAGTTTAGGCTGCTTCAGGAGACAATGTACATGACTG
TTGCCATCATTGATCGCT

ccnb1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ccnb1-005 (1) 876
mRNA ccnb1-201 (1) 1901
ccnb1-202 (1) 559
ccnb1-204 658
ccnb1-205 (1) 770
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ccnb1-204 Contained in:
OTHER ccnb1-204 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050168 (1)
  • Ensembl_Trans:ENSDART00000150070 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CO813427 (1) 752bp
    GenBank:BM102739 (1) 564bp
    CITATIONS (2)