Transcript

dpf2-006

ID
ZDB-TSCRIPT-110325-2476
Name
dpf2-006
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050100 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050100|OTTDARG00000035241|ZDB-GENE-041024-2 dpf2|no_translation dpf2-006 LG_ AL935065.8 Danio rerio protein_coding KNOWN, 421 bp
GCTGGGTGAGCAGTATTACAGGGACGCTCTGGAGCAGTGT
CACAACTATAATGCCCGTCTGTGTGCAGAGAGGAGCGTGA
GGATGCCCTTCCTCGACTCTCAGACCGGTGTCGCCCAGAG
CAACTGCTACTTCTGGATGGAGAAACGACACAGAGGACCA
GGTGTTGCTCCAGGTCAGCTGTACACATATCCAGCACGGC
GCTGGAGAAAGAAGAGGAGAGCCCACCCTCCAGATGACCC
TCGTCTGTCCTTCCCATCTCTAAAGACCGTTGCCAATGGA
TGTGAATGTGCGTGTGTATGTTTCAGAGCTGGATCTGGGG
ATTAAGAAGGATGTTTTCTCCAGTGATGGTAGCAGCTTAG
AGGCCCTTTTGAAAGGAGAGCCAGTGGATAAAAGATCTGG
ATTGGAGCTTCGCACGACAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations