Transcript

dpf2-201

ID
ZDB-TSCRIPT-110325-2475
Name
dpf2-201
Previous Names
  • dpf2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050097 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050097|OTTDARG00000035241|ZDB-GENE-041024-2 dpf2|OTTDARP00000039326 dpf2-001 LG_ AL935065.8 Danio rerio protein_coding KNOWN, 1708 bp
AACGCCCACTGTGAGCCCAGTAGAGCCAAGATGGCGGCGG
TGGTGGAGAATGTTGTCCAGCTGCTGGGTGAGCAGTATTA
CAGGGACGCTCTGGAGCAGTGTCACAACTATAATGCCCGT
CTGTGTGCAGAGAGGAGCGTGAGGATGCCCTTCCTCGACT
CTCAGACCGGTGTCGCCCAGAGCAACTGCTACTTCTGGAT
GGAGAAACGACACAGAGGACCAGGTGTTGCTCCAGGTCAG
CTGTACACATATCCAGCACGGCGCTGGAGAAAGAAGAGGA
GAGCCCACCCTCCAGATGACCCTCGTCTGTCCTTCCCATC
TCTAAAGACCGAGCTGGATCTGGGGATTAAGAAGGATGTT
TTCTCCAGTGATGGTAGCAGCTTAGAGGCCCTTTTGAAAG
GAGAGCCAGTGGATAAAAGATCTGGATTGGAGCTTCGCAC
GACAGAAGAGGAGCCCAGCTCTACTGAGTTCTCTACCGGG
GGACTGAACTCTAGCAGCAGGGTCCGAAAGAGAATTTTGG
AACCAGATGATTTTCTTGATGATCTAGATGATGAAGATTA
TGAGGAAGATACTCCAAAGAAACGTGGAAAAGGCAAAGGA
AAGGGACGTGGTGTCAGCAGTGCTCGCAAGAAGTTGGAAG
CAGCAGCTGCTTTGGAAGATCGGGACAGACCGTACGCTTG
TGACATCTGTGGAAAGCGCTATAAGAACAGGCCTGGTCTC
AGTTATCATTATGCCCACTCTCACTTGGCCGAGGAGGAAG
GAGAAGAGAAAGACGAGATGGACATTCGGGAACCAACTCC
ACCCCGGCAGGACGAACCCAAGACTCCTAAAAAAGGCCCA
GATGGTCTGGCTCTTCCGAACAACTACTGTGATTTCTGTT
TGGGAGATTCCAGCCTGAACCAGAAAACCGGCCAATCAGA
GGAGCTTGTGTCCTGCTCAGACTGTGGCCGTTCTGGTCAC
CCTTCATGTCTTCAGTTCACTCCTATCATGATGGCTGCTG
TGAAAACCTATCGCTGGCAGTGCATTGAGTGCAAGTGCTG
TAATATTTGTGGAACATCAGAAAATGATGATCAGCTGTTG
TTCTGTGATGACTGTGATCGAGGTTACCACATGTACTGCC
TCTCTCCCCCAATGTCTGTACCTCCTGAAGGAAGTTGGAG
TTGTCATCTGTGTTTGGCCCTCTTGAAAGAGAAAGCCTCC
ATATTCCAGAAGCAGAATGCACCGCCCCTGTGATGGTCCT
CTCAGGAAGACAGACCCTCTTTCTCATAGTTCCTTCCAAG
ATTTGTTTGGTTTAAGCAAACAAAATGGGTCGAACTGAAG
TTTTAATGGAAGAGAATAGGGACAAGCACCTCGCAGACAC
AAATGGAGGCAGAGAAAGAGAGAAGTGAGAAAAACGATGC
CCTTCTTCTCTTATTGCTCTCTCTCACATCTCAGCAGGTT
TGATCTCAGTATGACTGTTACACAGTTCCAAGTTTCAAAC
TTCCCTTGCTCTTTGTTTTCAACTATTATTCCTGACAAAT
AACATAATTCTTCCAAACTTCAAAACCCATCAGACACACT
ACTGAGCCTTTCAGTAGTATTTACATGGAGGAAGTCGCTA
TGAGAATATTATGACTCTTTTTGAGTTCCTGCTCATATTA
GACCTGATATTTCCACTTGTTTATGCAAACACTGTTTAAC
AAAGCAAAAAAACAAAAAATAACAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations