ZFIN ID: ZDB-TSCRIPT-110325-2396
Transcript Name: odc1-201
Previous Name: odc1-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049688 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049688|OTTDARG00000034974|ZDB-GENE-010816-1 odc1|OTTDARP00000038978 odc1-003 LG_ CU638706.4 Danio rerio protein_coding KNOWN, 545 bp
AATGGGAACACTCTTTGTAAATGCGTTTTAAGAATTCTTG
CTTGAGAGAAGTACACACCGGCCCTGGCCTTGAGGCTTAT
CTGAAAGGTTTCAACTTCACTGGTGAACCTCCTTGGCTGT
CTGACATCTGTTAGCCACGTTTCAATCCCATCTCTTCCAT
TCGTCTGGATGATAAAGATGCCTTCTATGTGGCGGATCTG
GGGGATGTCCTGAAGAAGCACCTCCGCTGGCTGCGTGTTT
TGCCCCGCATCACGCCGTTTTACGCAGTGAAGTGCAACGA
TAGCAGGGCGGTGGTCACCACACTGGCGTCTCTGGGAGCC
GGGTTCGACTGTGCCAGCAAAACGGAGATCCAGATCGTGC
AGTCAGTGGGTGTGGATCCCAGCAGGATCATCTACGCCAA
CCCGTGCAAGCAGGTTTCGCAGATCAAATACGCCTCGGCT
CACGGCGTGCAGATGATGACGTTCGACAGCGAGGTGGAGC
TCATGAAGGTGGCCCGTAGCCACGAAAATGCCAAGCTGGT
TCTCCGCATCGCCACAGACGACTCG

odc1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA odc1-201 545
odc1-202 (1) 2140
odc1-203 (1) 734
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
odc1-201 Contained in:
[Fosmid] CH1073-378J2 (1) (order this)
OTHER odc1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049688 (1)
  • Ensembl_Trans:ENSDART00000148869 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:FP108214 (1) 586bp
    CITATIONS (2)