ZFIN ID: ZDB-TSCRIPT-110325-1488
Transcript Name: odc1-202
Previous Name: odc1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049687 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049687|OTTDARG00000034974|ZDB-GENE-010816-1 odc1|OTTDARP00000038977 odc1-001 LG_ CU638706.4 Danio rerio protein_coding KNOWN, 2140 bp
CAGTGCCGAAGCACCGGCTTTTACTCGGTCCGAGAATCAG
CAGATCACACCAGCCCGTCGAGCCAGGAGAAATACAGCAT
TTTTCATTTCCAGCACTCTGGTCTAATGGGAACACTCTTT
GTAAATGCGTTTTAAGAATTCTTGCTTGAGAGAAGTACAC
ACCGGCCCTGGCCTTGAGGCTTATCTGAAAGGTTTCAACT
TCACTGGTGAACCTCCTTGGCTGTCTGACATCTGTTAGCC
ACGTTTCAATCCCATCTCTTCCATTCGTCTGTTTCTTTTG
CAATCAAATCTTGAACAAACACTATGACGGCTTGCACCGG
ATCAGACTTTGACTTCGCCTTCCTGGAGGAGGGATTCTGT
GCGCGCGATATCGTGGAGCAGAAGATCAATGAGTCCTCGC
TCTCAGATGATAAAGATGCCTTCTATGTGGCGGATCTGGG
GGATGTCCTGAAGAAGCACCTCCGCTGGCTGCGTGTTTTG
CCCCGCATCACGCCGTTTTACGCAGTGAAGTGCAACGATA
GCAGGGCGGTGGTCACCACACTGGCGTCTCTGGGAGCCGG
GTTCGACTGTGCCAGCAAAACGGAGATCCAGATCGTGCAG
TCAGTGGGTGTGGATCCCAGCAGGATCATCTACGCCAACC
CGTGCAAGCAGGTTTCGCAGATCAAATACGCCTCGGCTCA
CGGCGTGCAGATGATGACGTTCGACAGCGAGGTGGAGCTC
ATGAAGGTGGCCCGTAGCCACGAAAATGCCAAGCTGGTTC
TCCGCATCGCCACAGACGACTCGAAGGCTGTTTGCAGGCT
GAGTGTGAAGTTTGGAGCGACGCTGAAGAGCAGCCGGCTG
CTGCTGGAGAGAGCAAAAGAGCTCGGGCTGGACGTGATCG
GGGTCAGTTTCCATGTGGGCAGCGGCTGTACGGACCCGGA
AACATACAGCCAGGCCATCTCAGATGCTCGCTATGTTTTC
GACATTGGGGCGGAGCTGGGCTATAACATGAGCCTGCTGG
ACATCGGCGGAGGATTTCCAGGCTCTGAGGACACCAAACT
CAAGTTTGAAGAGATTGCTGCTGTTATTAACCCTGCGCTG
GATAAATACTTCCCTGTGGACTCTGGCGTGAGGATCATCG
CTGAACCCGGCCGTTATTATGTAGCATCTGCTTACACACT
GGCGGTCAACATCATCGCCAAAAAGGTCATCATGAAGGAG
CAGTCAGCCTCCGATGAAGAAGAGGATGTGTCCAATGACC
GAACCCTGATGTACTACGTGAATGACGGCGTTTATGGCTC
CTTCAACTGCATCCTGTATGATCATGCGCACGTGTTGCCA
ACTCTGCACAAGAAACCCAAGCCCGATGAGCGCATGTACC
CCTGCAGTATCTGGGGCCCGACCTGCGACGGTCTGGACCG
CATTGTGGAGCAGTGCAGCCTGCCGGACATGCAGGTGGGC
GACTGGCTGCTGTTCGAGAACATGGGCGCCTACACCGTCG
CCGCATCCTCCACCTTCAATGGCTTCCAGAAACCCGATAT
TTATTACATCATGTCCCGAACAGCCTGGCAGTGCATGCAG
CAGATTCGTGCCCAGGGGATTCCTGCACTTCCATTGGAGG
AGCCGAGCGCTGGAAACGTGCCATCCCACTGCGGGCGCGA
GAGCAGTCTGGATGTTCCCGCCAAACCCTGCCCGACTCAA
GTGCTGTAGCAGAAGACGCTCAACCAAACCTGCTCTCGGG
TCCAGCTAATGCAGATCTGTGTTACTGATCTCCAACTTCT
GATCTAAACGCCTCAGAGCTGAGGAGAAAACAAACGCACA
GTCCAATTCTTATTTCCTGTTATCTTTGTTTTAACTGGTT
TTTGTTGATTGTCTGTATTTGTATTTCGAGGCCAGATGCT
TGAGCGAGGACTTCTTCCTCTTCCTCAGTGACCATTTCCA
TTTTATACTTGATTAGTAACTTAATTTTTTAATATTGAGT
TGAAGTCTTTGTATTATAATTATTCAGAGCTGAGCTTGTA
TGCCACTGGTGCATTTGAAACGGACGTGAAAGAGATGGGA
TTGCATCTATTATGCTTTCCTATGGAAACTGCTTTTTGTT
TTTTTTAAGTATTACGTTTTTTTGTATTTTTATATAAATA
AAGATGCTGTAAAATGGCAA

odc1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA odc1-201 (1) 545
odc1-202 2140
odc1-203 (1) 734
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
odc1-202 Contained in:
[Fosmid] CH1073-378J2 (1) (order this)
OTHER odc1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049687 (1)
  • Ensembl_Trans:ENSDART00000149039 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AB069857 (1) 2154bp
    GenBank:BC063932 (1) 2131bp
    GenBank:CO797584 (1) 817bp
    GenBank:DV587223 (1) 804bp
    GenBank:CF997090 (1) 779bp
    CITATIONS (2)