header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-2126
Transcript Name: pck1-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048731 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048731|OTTDARG00000034445|ZDB-GENE-030909-11 pck1|no_translation pck1-002 LG_ CU855794.4 Danio rerio protein_coding KNOWN, 708 bp
AACTCACTGCTGGGGAAGAAGTGCTTCGCTCTGCGCATCG
CATCACGCATCGCTAAAGAGGAGGGCTGGCTGGCAGAACA
CATGCTGATTCTGGGCATCACCAACCCGGCGGGACAGAAG
AAGTATTTCGCAGCGGCGTTCCCCAGCGCCTGCGGGAAGA
CCAACCTGGCCATGCTGAAGCCGTCGCTGCCCGGCTGGAA
GGTGGAGTGTGTGGGAGACGACATCGCATGGATGAAGTTC
GACAAAGAAGGGAATCTGAGAGCCATCAACCCAGAGAACG
GCTTCTTCGGTGTGGCTCCGGGAACCTCCAGCAAAACCAA
CCCCAACGCCATGAGCACCATCAGCTGCAACACACTCTTC
ACCAACGTGGCGGAGAGCAGTGACGGAGGGGTGTTCTGGG
AGGGCATGGATGAGGATCTGCCTGAAGGAGTGACGCTGAC
GTCCTGGAAGAACCAGCCCTGGACACCAGAGGACGGTGAG
TGACATCTGAAATGATCAGCTTCATCTTTAACTGTTCACT
CTTCCTCAAGAGGTCGTAATCCCTCAGGAGTTTCATTCCT
CTGCTGAACATAAAGGAAGATATTTGGAAGAATGCTGAAA
ACCCAATGTAGGAAAAGCAAATAGAGTCAATGAATACAGG
TTTGGAGATTTCTTCAAAATATCTTCTTCTGTGTCTAATA
GAAGAAAGAAACTTGGTAAAGGATGAGG

pck1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA pck1-002 708
mRNA pck1-201 (1) 2662
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pck1-002 Contained in:
[Fosmid] CH1073-127N10 (1) (order this)

OTHER pck1-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048731 (1)
  • Ensembl_Trans:ENSDART00000148691 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DY556603 (1) 720 bp
    CITATIONS (2)