ZFIN ID: ZDB-TSCRIPT-110325-1218
Transcript Name: pck1-201
Previous Name: pck1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048730 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048730|OTTDARG00000034445|ZDB-GENE-030909-11 pck1|OTTDARP00000038244 pck1-001 LG_ CU855794.4 Danio rerio protein_coding KNOWN, 2662 bp
GTGTGTGTGTGTGTGTGTGGGTGTATATAAGGTCTGACTG
GCACACAGTGAGCAGAACACAGATGAACATCATCATCATC
ATCATCACCACAGACTGATGAAGAGCTGCTAAACCTTCAC
TCAAGGCTCTCTCTCTCTCTCTCTCTCTTGGTCAGCATCT
CTCCATCCCTCCGCTCATCATGCCTCCTCAGCTGCAGTCT
CAGGACCGGTCATGCCCGCGGGTCCTGCAGGGCGATCTGG
CGTCTCTGAGCGCCAGCGTGCGGGAGTTCATCGACAGCAG
TGTGAGTCTGTGCCAGCCGGACGCTCTGCACATCTGTGAC
GGCTCCGAGCAGGAGAACAGCACCATCCTCAGCCTGCTGG
AGGAGCAGGGCGCCATCAAGAGGCTGCGCAAGTACAGCAA
CTGCTGGTTGGCGCGCACTGACCCACGTGATGTGGCCCGT
GTGGAGAGTAAAACGGTGATCGTGACGGCGGAGCAGCGGG
ACACGGTTCCCACACCGACTGGAGGAGGAGTCAGTCAGCT
GGGCCGCTGGATGTGTCCTGAGGAGTGGGACAAAGCCATG
AACCTGCGCTTCCCTGGCTGCATGAAAGGGCGTGTGATGT
ACGTGATCCCCTTCAGCATGGGGCCGGTGGGCTCTCCGCT
CTCCAAGATCGGGGTGGAGCTGACGGACTCGCCGTATGTG
GTGGCCAGCATGCGGATCATGACGCGGATGGGGAAAACTG
TGCTGAGCGCGCTGGGAAACGGAGAGTTCGTCCGGTGTCT
GCACTCAGTCGGCTGCCCGCTGCCACTCAGGAAGCCGCTG
GTCAACAACTGGCCCTGTAACCCGGAGCTGACGCTGGTGG
CCCACATCCCGGATCAGAGGAAGATCGTGTCGTTCGGCAG
CGGATACGGAGGAAACTCACTGCTGGGGAAGAAGTGCTTC
GCTCTGCGCATCGCATCACGCATCGCTAAAGAGGAGGGCT
GGCTGGCAGAACACATGCTGATTCTGGGCATCACCAACCC
GGCGGGACAGAAGAAGTATTTCGCAGCGGCGTTCCCCAGC
GCCTGCGGGAAGACCAACCTGGCCATGCTGAAGCCGTCGC
TGCCCGGCTGGAAGGTGGAGTGTGTGGGAGACGACATCGC
ATGGATGAAGTTCGACAAAGAAGGGAATCTGAGAGCCATC
AACCCAGAGAACGGCTTCTTCGGTGTGGCTCCGGGAACCT
CCAGCAAAACCAACCCCAACGCCATGAGCACCATCAGCTG
CAACACACTCTTCACCAACGTGGCGGAGAGCAGTGACGGA
GGGGTGTTCTGGGAGGGCATGGATGAGGATCTGCCTGAAG
GAGTGACGCTGACGTCCTGGAAGAACCAGCCCTGGACACC
AGAGGACGGTGAACCGTGTGCTCACCCGAACTCCCGCTTC
TGTACGCCGGCCGCTCAGTGTCCCATCATCGACCCGCAGT
GGGAGTCTCCTGAAGGCGTCCCCATCGAGGCCATCATCTT
CGGCGGGCGGCGTCCGCAGGGCGTCCCGCTGGTGTACGAG
GCCTTCGACTGGGCGCACGGAGTGTTTGTAGGGGCGTCCA
TGAGGTCAGAGGCCACGGCGGCTGCTGAACACAAAGGTAA
AGTGATCATGCATGACCCGTTCGCCATGCGTCCGTTCTTC
GGCTATAACTTCGGTCAGTATCTCTCCCACTGGCTGAGCA
TGGAGCAGCGGCCCGGCGCTAAGCTGCCCAAAATCTTCCA
CGTCAACTGGTTCGGCAGGAGCTCCTCGGGGCGCTTCCTG
TGGCCGGGCTTTGGGGAGAACATCCGCGTACTGGAGTGGA
TGTTCGGCAGGCTGAGCGGAGGGGCCGAGGCGAGGACCAC
TGCGGTGGGGCTGGTGCCTGCAGACGGTGCCCTGAACCTG
CACGGGCTCCCGGATGTGGAGCCGCTGGAGCTCTTCAGGG
TCTCGCAGGAGTTCTGGATGCAGGAGCTGCAGGAGATCAG
AGAGTATTTCAGCCGTGAACTGAACCGAGACCTGCCGCAG
GAGATGCAGAGACAGCTGGAGCTGCTGGAGCACAGGCTCA
CACACACACACGTGAGCAGTAAACACGGCTGAAGACACGC
AACACACACATGTTAATCTGCATTATGCACACTTAAAGGG
ACGGTGCACTCGAATATTAAAAATATGTCATCGTTTGCTC
TCAAGTGCATCAAAACCGTTCTTTAGTTTCCTTCTGTTGA
ACACAGAAGAAGATATTTTGAAAAATGCTGAAGATTGTTC
ACTTCCACAGTATTTAATTTCTTTCCCTCTTTTTGTTTAC
TTTTTATTTAGTGTTTTTTCTTTTGTGTGTGTGTGTGTGT
GTTTACTGAGAAAACTCATTTAAAGAGACAGAACACACAC
AATAATCAGCATTTATGCACAGTTAAAGGGACGGTGCTCT
CTAAAATGAAAAATATGTCACCATTTGTTTTAACCCTGAA
CACAAAAGAAGATATTCAGAGAAATGCTGAAGATCGTTGG
CGTCTTCAGGAAGGACTGTTTGTTATTTAACCTTATAAAT
TATTGATGCGCACATTTATTTTCTGCTGGAGATGTTATGG
CGGATACCTTTAAGCAACCTTCTCATTTTTAAATGTGGTA
ATTTATTTTTCTATGTATTTCTATGTCAGTCTTCCATGAT
ATTAATAAAGTTTTTAAATATA

pck1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA pck1-002 (1) 708
mRNA pck1-201 2662
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pck1-201 Contained in:
[Fosmid] CH1073-127N10 (1) (order this)
OTHER pck1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048730 (1)
  • Ensembl_Trans:ENSDART00000008752 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC053122 (1) 2698bp
    GenBank:CD751254 (1) 772bp
    GenBank:EB951703 (1) 588bp
    CITATIONS (2)