Community Action Needed: Please respond to the NIH RFI
Transcript

pck1-201

ID
ZDB-TSCRIPT-110325-1218
Name
pck1-201
Previous Names
  • pck1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048730 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048730|OTTDARG00000034445|ZDB-GENE-030909-11 pck1|OTTDARP00000038244 pck1-001 LG_ CU855794.4 Danio rerio protein_coding KNOWN, 2662 bp
GTGTGTGTGTGTGTGTGTGGGTGTATATAAGGTCTGACTG
GCACACAGTGAGCAGAACACAGATGAACATCATCATCATC
ATCATCACCACAGACTGATGAAGAGCTGCTAAACCTTCAC
TCAAGGCTCTCTCTCTCTCTCTCTCTCTTGGTCAGCATCT
CTCCATCCCTCCGCTCATCATGCCTCCTCAGCTGCAGTCT
CAGGACCGGTCATGCCCGCGGGTCCTGCAGGGCGATCTGG
CGTCTCTGAGCGCCAGCGTGCGGGAGTTCATCGACAGCAG
TGTGAGTCTGTGCCAGCCGGACGCTCTGCACATCTGTGAC
GGCTCCGAGCAGGAGAACAGCACCATCCTCAGCCTGCTGG
AGGAGCAGGGCGCCATCAAGAGGCTGCGCAAGTACAGCAA
CTGCTGGTTGGCGCGCACTGACCCACGTGATGTGGCCCGT
GTGGAGAGTAAAACGGTGATCGTGACGGCGGAGCAGCGGG
ACACGGTTCCCACACCGACTGGAGGAGGAGTCAGTCAGCT
GGGCCGCTGGATGTGTCCTGAGGAGTGGGACAAAGCCATG
AACCTGCGCTTCCCTGGCTGCATGAAAGGGCGTGTGATGT
ACGTGATCCCCTTCAGCATGGGGCCGGTGGGCTCTCCGCT
CTCCAAGATCGGGGTGGAGCTGACGGACTCGCCGTATGTG
GTGGCCAGCATGCGGATCATGACGCGGATGGGGAAAACTG
TGCTGAGCGCGCTGGGAAACGGAGAGTTCGTCCGGTGTCT
GCACTCAGTCGGCTGCCCGCTGCCACTCAGGAAGCCGCTG
GTCAACAACTGGCCCTGTAACCCGGAGCTGACGCTGGTGG
CCCACATCCCGGATCAGAGGAAGATCGTGTCGTTCGGCAG
CGGATACGGAGGAAACTCACTGCTGGGGAAGAAGTGCTTC
GCTCTGCGCATCGCATCACGCATCGCTAAAGAGGAGGGCT
GGCTGGCAGAACACATGCTGATTCTGGGCATCACCAACCC
GGCGGGACAGAAGAAGTATTTCGCAGCGGCGTTCCCCAGC
GCCTGCGGGAAGACCAACCTGGCCATGCTGAAGCCGTCGC
TGCCCGGCTGGAAGGTGGAGTGTGTGGGAGACGACATCGC
ATGGATGAAGTTCGACAAAGAAGGGAATCTGAGAGCCATC
AACCCAGAGAACGGCTTCTTCGGTGTGGCTCCGGGAACCT
CCAGCAAAACCAACCCCAACGCCATGAGCACCATCAGCTG
CAACACACTCTTCACCAACGTGGCGGAGAGCAGTGACGGA
GGGGTGTTCTGGGAGGGCATGGATGAGGATCTGCCTGAAG
GAGTGACGCTGACGTCCTGGAAGAACCAGCCCTGGACACC
AGAGGACGGTGAACCGTGTGCTCACCCGAACTCCCGCTTC
TGTACGCCGGCCGCTCAGTGTCCCATCATCGACCCGCAGT
GGGAGTCTCCTGAAGGCGTCCCCATCGAGGCCATCATCTT
CGGCGGGCGGCGTCCGCAGGGCGTCCCGCTGGTGTACGAG
GCCTTCGACTGGGCGCACGGAGTGTTTGTAGGGGCGTCCA
TGAGGTCAGAGGCCACGGCGGCTGCTGAACACAAAGGTAA
AGTGATCATGCATGACCCGTTCGCCATGCGTCCGTTCTTC
GGCTATAACTTCGGTCAGTATCTCTCCCACTGGCTGAGCA
TGGAGCAGCGGCCCGGCGCTAAGCTGCCCAAAATCTTCCA
CGTCAACTGGTTCGGCAGGAGCTCCTCGGGGCGCTTCCTG
TGGCCGGGCTTTGGGGAGAACATCCGCGTACTGGAGTGGA
TGTTCGGCAGGCTGAGCGGAGGGGCCGAGGCGAGGACCAC
TGCGGTGGGGCTGGTGCCTGCAGACGGTGCCCTGAACCTG
CACGGGCTCCCGGATGTGGAGCCGCTGGAGCTCTTCAGGG
TCTCGCAGGAGTTCTGGATGCAGGAGCTGCAGGAGATCAG
AGAGTATTTCAGCCGTGAACTGAACCGAGACCTGCCGCAG
GAGATGCAGAGACAGCTGGAGCTGCTGGAGCACAGGCTCA
CACACACACACGTGAGCAGTAAACACGGCTGAAGACACGC
AACACACACATGTTAATCTGCATTATGCACACTTAAAGGG
ACGGTGCACTCGAATATTAAAAATATGTCATCGTTTGCTC
TCAAGTGCATCAAAACCGTTCTTTAGTTTCCTTCTGTTGA
ACACAGAAGAAGATATTTTGAAAAATGCTGAAGATTGTTC
ACTTCCACAGTATTTAATTTCTTTCCCTCTTTTTGTTTAC
TTTTTATTTAGTGTTTTTTCTTTTGTGTGTGTGTGTGTGT
GTTTACTGAGAAAACTCATTTAAAGAGACAGAACACACAC
AATAATCAGCATTTATGCACAGTTAAAGGGACGGTGCTCT
CTAAAATGAAAAATATGTCACCATTTGTTTTAACCCTGAA
CACAAAAGAAGATATTCAGAGAAATGCTGAAGATCGTTGG
CGTCTTCAGGAAGGACTGTTTGTTATTTAACCTTATAAAT
TATTGATGCGCACATTTATTTTCTGCTGGAGATGTTATGG
CGGATACCTTTAAGCAACCTTCTCATTTTTAAATGTGGTA
ATTTATTTTTCTATGTATTTCTATGTCAGTCTTCCATGAT
ATTAATAAAGTTTTTAAATATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations