header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-2103
Transcript Name: rcbtb1-202
Previous Name: rcbtb1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048644 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048644|OTTDARG00000019484|ZDB-GENE-030131-7951 rcbtb1|OTTDARP00000038162 rcbtb1-002 LG_ BX294379.5 Danio rerio protein_coding KNOWN, 801 bp
GTTTCCGTGGGCAACTGAGAGCACAGCTACAGGACCTGGT
TAAGTCGCTAAATACATGCTGTCGAAGTCTCTGTGTTCAC
TAGGGATCTGCCATGGTGGATGTGAGTAAGTGGCCTCTCT
TCACCCTCTTGAGTGCACAGGAGCTCTCCTCTATTCGACA
GGCATGCATCTTTGGCGCGTCTGCGAATGAGGCCATCTAC
ATCACCCACGATGATGAAGTGTACGTGTTGGGTTTGAACT
GCAGTAACTGTCTGGGCACTGGAGACAGTCAGAGCACCAT
CGCTCCAAAAAAGCTGGACTGCCTGAGTGGGAAGAAGCTG
ATCAGTTTGAGCTATGGCAGCGGACCTCATGTTTTGCTGG
TCACTGAAGACGGGGAGTTGTATGCATGGGGGCATAATGG
ATACAGTCAGTTGGGCAATGGGACGACCAATCAAGGTGTA
TCTCCTATTTTGGTGTCTACAAATCTGCAGGGCAAGAGGG
TGACTGAGGTGTCTTGTGGTTCACACCACTCTTTGGCTCT
GACCCATGAGGGTGAGGTGTTCGCATGGGGCTACAATAAC
TGTGGTCAGGTGGGTTCAGGGTCCACTGCCAACCAGCCTA
CACCACGAAAAGTCTCCAACTGTCTGCAGAACAAAGTGAT
TGTTAATATAGCCTGTGGACAGACCTCATCAATGGCTGTG
ACGGATAATGGTGAGGTTTACGGCTGGGGTTACAATGGTA
ATGGCCAGCTGGGGTTGGGCAACAATGGGAACCAGCTCAC
GCCATGCCGTTTGATTGCACTACAAGGCTTCTGTGTGCTG
C

rcbtb1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA rcbtb1-201 (1) 2750
rcbtb1-202 801
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rcbtb1-202 Contained in:
[BAC] DKEY-7A20 (1) (order this)

OTHER rcbtb1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048644 (1)
  • Ensembl_Trans:ENSDART00000148759 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EE319107 (1) 903 bp
    CITATIONS (2)