header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-6884
Transcript Name: rcbtb1-201
Previous Name: rcbtb1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023949 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023949|OTTDARG00000019484|ZDB-GENE-030131-7951 rcbtb1|OTTDARP00000019836 rcbtb1-001 LG_ BX294379.5 Danio rerio protein_coding KNOWN, 2750 bp
TCCTCGCTTACGTGAACTCGTTTCCGTGGGCAACTGAGAG
CACAGCTACAGGACCTGGTTAAGTCGCTAAATACATGCTG
TCGAAGTCTCTGTGTTCACTAGTTTCACAATTCAGGGATC
TGCCATGGTGGATGTGAGTAAGTGGCCTCTCTTCACCCTC
TTGAGTGCACAGGAGCTCTCCTCTATTCGACAGGCATGCA
TCTTTGGCGCGTCTGCGAATGAGGCCATCTACATCACCCA
CGATGATGAAGTGTACGTGTTGGGTTTGAACTGCAGTAAC
TGTCTGGGCACTGGAGACAGTCAGAGCACCATCGCTCCAA
AAAAGCTGGACTGCCTGAGTGGGAAGAAGCTGATCAGTTT
GAGCTATGGCAGCGGACCTCATGTTTTGCTGGTCACTGAA
GACGGGGAGTTGTATGCATGGGGGCATAATGGATACAGTC
AGTTGGGCAATGGGACGACCAATCAAGGTGTATCTCCTAT
TTTGGTGTCTACAAATCTGCAGGGCAAGAGGGTGACTGAG
GTGTCTTGTGGTTCACACCACTCTTTGGCTCTGACCCATG
AGGGTGAGGTGTTCGCATGGGGCTACAATAACTGTGGTCA
GGTGGGTTCAGGGTCCACTGCCAACCAGCCTACACCACGA
AAAGTCTCCAACTGTCTGCAGAACAAAGTGATTGTTAATA
TAGCCTGTGGACAGACCTCATCAATGGCTGTGACGGATAA
TGGTGAGGTTTACGGCTGGGGTTACAATGGTAATGGCCAG
CTGGGGTTGGGCAACAATGGGAACCAGCTCACGCCATGCC
GTTTGATTGCACTACAAGGCTTCTGTGTGCTGCAGATTGC
ATCAGGTTATGCTCATTCGCTAGCACTGACCGATGAGGGC
CTGCTGTATGCATGGGGTGCAAACACTTATGGCCAGCTGG
GCACTGGCAACAAGAGTAACCAGCTCAGCCCTGTACAGGT
CATGACTGAGAAAGAAAGGATTGTGGAGATCGCCGCCTGT
CACTCCACGCACACCTCTGCGGCGAAAACCCAGAGCGGTC
AGGTGTATATGTGGGGACAGTGTCGCGGTCAGGCCATTGT
GCTGCCACACCTCACACACTTCGCCAGCACGGACGACGTA
TTTGCCTGCTTTGCCACACCATCTGTAATGTGGCGGATGC
TGTCCATGGAGCATGATGATTTCTTGACTGTGGCCCAGTC
CCTTAAAAAGGAGTTTGATAATCCAGAGACCTCTGACCTT
AAGTTCAGCATTGATGGGAAGTACATCCATGTCCATAAAG
CTGTTCTCAAAATCAGGTGTGAGCACTTCAGATCAATGTT
TCAGTCACACTGGAATGAAGATATGAAGGAGGTGATTGAG
ATCGATCAGTTCTCGTACCCGGTGTACCGCTCTTTCCTGG
AGTTCCTCTACACTGACAGTGTTGATCTTCCTCCTGAGGA
CGCCATCGGACTTCTGGACTTGGCAACCTCATACTGTGAA
AACAGGCTGAAGAAGTTGTGCCAGCACATCATCAAGAGAG
GCATCACGGTGGAGAACGCCTTCTCTCTGCTGTCTGCTGC
CATCAGATATGATGCCGAGGATCTAGAGGAGTTCTGTTTT
AAATTCTGTGTCAACCACTTGACCGAGGTCACGCAGACAG
CTGCGTTCTGGCAGATCGACGGCAACATGCTGAAGGAGTT
TATCTGCAGAGCCAGCCACTGTGGAGCCTTCAAAAACTGA
CTCTGACATCCAGCAGACGCACGCACACACACAAACACAC
ACACACCATACATGTGGATCCATCTGTTGCTGCAGTCGCT
CCTCCAGGCAGATAAAGGGCGCTGCTACACCAGACGGTCA
TCGCGCACACTGCCCCCTGTCGAGCGTCAGAGGAACTCCC
GTGATGGATCAGATGCTTGAAGAAGGGTTTAGACCTCTGT
TAATCTCACGTACAACCATTTTGTACTACATTACAGACAG
AGGAGATTTCTGTTGTGTGTTATATGCCTAGAGTACATTT
CTAGTGCTGCAGATGGAGGAATAGTGTGAGTTTTTGGGCC
AAATAAAGGCATAGTTCAGCTGTGATGCATAAACGTACCA
CTAAAAAGCAGACAGGGGGACAGATTTGTTCTTTATGTTG
TTGTTTTTTCCTTCTTCATAAGGTAATATTCAACAGGTCA
CTAATTAGGTTTCTTGCAGTGATGCAGTGCATTACAAGTT
GCTCTTTTTATTGTGTGGTATAGGCTGGGATCTGTAAATG
TGCATTAAGGTGGACTCAGTCAGCAGACGTTGATGTGGGC
TCGTTTTTTTTAATGTTACTGACCAAAACCTGCTCTATTT
TGTTATTGCTTGATGTGAAGGCTTAACTTTTGCTCTTCAG
ATAAAGAAAGCTATATTAGTTGTTAATGCTTTGGCCGTTT
AGAAGCTGTGCGAAGCAGCATCTGCAGTATTGACCGTTAC
ATTTTAGTCCGATGTTTAAGTTTGATTAAGTATTACTGAT
AGTTGCACTAGTGGTCGGATCACTACAGGGTTTCTATCAA
TCTTTGCACCTTTTATTTTGGTGTGAAGCACTTGGATTTC
ACAATGCTGATGCCTGTGGAGAGATTTATTTGTTACAAAT
GGCTGTGTTTGTGTTTTTCACATGTACATACTGTACAGTT
TTTGCATTAGTTTTGTAAATTTAACCTGTGCACATCACGT
GTGCCGCAGTTTCTCTTGTAAGTTATGAATTTGATCCATT
AAAAATAAATAAAGCTTTTCTTAAAAGTTA

rcbtb1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA rcbtb1-201 2750
rcbtb1-202 (1) 801
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rcbtb1-201 Contained in:
[BAC] DKEY-7A20 (1) (order this)

OTHER rcbtb1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000023949 (1)
  • Ensembl_Trans:ENSDART00000053222 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC045877 (1) 2771 bp
    GenBank:BI877054 (1) 677 bp
    GenBank:BM957748 (1) 654 bp
    GenBank:BI878598 (1) 577 bp
    GenBank:BI702641 (1) 345 bp
    GenBank:BI704911 (1) 250 bp
    CITATIONS (2)