Transcript

lta4h-002

ID
ZDB-TSCRIPT-110325-1841
Name
lta4h-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030875 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030875|OTTDARG00000007273|ZDB-GENE-040426-2477 lta4h|no_translation lta4h-002 LG_ BX649411.10 Danio rerio protein_coding KNOWN, 607 bp
CAGTTTCAGACCCTAGCTCCTTCTCCTCGCTCTCCAAGTG
CTCTACCAAGCACTTAAACCTCATTTACCATGTCGACTTT
GACAGGCATGTGCTCAAAGGGAAAGTCGCCCTGACTGTGG
AGGTCCTGGAGGATAAATTCTCTTCTCTGACCCTGGACTC
TAAGGACCTGAAGATCTCTAAGGTGTCTGCGAATGGCCAA
GCTGCAAAGTTTGAACTTGGAGCCAAGCATAAATTTAAGG
GATCCCCTTTGGAAATCACCCTGCCTTTTGAACTCTCACG
CGGTCAGCATGTGATTGTGGAGATCGAATATGAGACGTCT
CCTACTGCCACTGCTCTTCAATGGTTAACACCCAAACAGA
CTGCTGGGAAAAAACATCCATACCTTTTCAGCCAATGCCA
GGCCACTCATTGCAGGACCATGGTGCCTTGCCAGGACACT
CCATCAGTGAAGCACACTTACTATGCCCAGGTTTCTGTCC
CGAGAGAGCTGGTGGCATTGATGAGTGCATTGCGAGATGG
GCAGGAACCAGATCCAAGTGACAGCAGCAGAGTCATCTAT
CGCTTCAGACAGCCGGTCAGTGTTTCGTCCTCGTTCTGTT
GGATTCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations