Transcript

lta4h-201

ID
ZDB-TSCRIPT-110325-1
Name
lta4h-201
Previous Names
  • lta4h-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000008194 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000008194|OTTDARG00000007273|ZDB-GENE-040426-2477 lta4h|OTTDARP00000007228 lta4h-001 LG_ BX649411.10 Danio rerio protein_coding KNOWN, 2151 bp
ATTCGCAGCGCGAGCCGAGTGCTCTCTGCTCAACCATGAC
TCCAGTTTCAGACCCTAGCTCCTTCTCCTCGCTCTCCAAG
TGCTCTACCAAGCACTTAAACCTCATTTACCATGTCGACT
TTGACAGGCATGTGCTCAAAGGGAAAGTCGCCCTGACTGT
GGAGGTCCTGGAGGATAAATTCTCTTCTCTGACCCTGGAC
TCTAAGGACCTGAAGATCTCTAAGGTGTCTGCGAATGGCC
AAGCTGCAAAGTTTGAACTTGGAGCCAAGCATAAATTTAA
GGGATCCCCTTTGGAAATCACCCTGCCTTTTGAACTCTCA
CGCGGTCAGCATGTGATTGTGGAGATCGAATATGAGACGT
CTCCTACTGCCACTGCTCTTCAATGGTTAACACCCAAACA
GACTGCTGGGAAAAAACATCCATACCTTTTCAGCCAATGC
CAGGCCACTCATTGCAGGACCATGGTGCCTTGCCAGGACA
CTCCATCAGTGAAGCACACTTACTATGCCCAGGTTTCTGT
CCCGAGAGAGCTGGTGGCATTGATGAGTGCATTGCGAGAT
GGGCAGGAACCAGATCCAAGTGACAGCAGCAGAGTCATCT
ATCGCTTCAGACAGCCGGTCCCCATGCCTTCTTACCTTAT
CGCCATTGTAGTTGGTGCTTTGGAAAGCAGGGAAATCGGC
CCAAGGTCTAGAGTTTGGTCTGAGAAGGAATATGTGGATG
AAGCTGCATATGAGTTTGCAGAGACTGAGACCATGTTAAA
GACGGCTGAGAGTCTGGCAGGGCCATATGTTTGGGGCCAG
TATGATGTCCTGGTTCTGCCTCCATCCTTCCCATATGGAG
GCATGGAGAACCCCTGCCTCACATTTGTCACTCCAACTGT
GTTGGCTGGAGACAGATCTCTTGCTGGTGTCATTGCTCAT
GAGATTTCCCACAGCTGGACAGGAAACCTGGTGACCAACA
GGACTTGGGAGCATTTCTGGCTAAATGAAGGTCATACGGT
GTATATCGAGAGAATGATAGCCAGGTGTATGGAGGGTGAG
CAGCTCAGGCAGTTTAAAGGCATTGGAGGATGGAAAGAAC
TTCATGAGTCTGTGAAACAGTTTGGAGCAAATAATGTCCT
CACAAACCTGGTCCCAAATCTGCATGAGGTGGACACAGAT
GAAGCCTTTTCCTCAGTGCCCTATGAGAAGGGATTTGCTC
TGCTTTATCATCTGGAGGAACTGATGGGAGGCCCAGAGGT
TTTCATGGGATTCGTGAAGTCCTACATTCAGCTGTTTGCC
TACGGCAGTGTAACAACAGAGGAATGGAAGAACTATCTGT
TCACTTACTTTAAAGACAAGGTGGACATCTTGAATAAAGT
GGACTGGAATGCATGGATGCACACTCCAGGAATGGCCCCC
GTCAGACCACAGTATGACACCACTATGGCGGACGCCTGCA
CTTCTCTGTGTCAGAAATGGGTGAAGGCAAAGGAAGCTGA
CCTCGCAAGTTTCACTGAGGCAGATGTGAAGCAATTGAAC
TCGCCTCAGCTTATTGAGTTTATGGCTTTGCTGCTCCAAG
AGGATCCCCTTCCTCTGTCCCACGTGAAGAAGATGGGGGA
GGTTTACAAGCTGAACAATATTAAAAATGCAGAGGTTCGC
TTCAGGTGGTTGCGCATCTGTGTAAAGGCTCAATGGGAAG
AAGCTGTTCCTTTGGCACTTAAAATGGCAACCGAACAGGG
CAGAATGAAATTCACTCGCCCACTTTTTAAGGAAGTGTAC
AACTTCTCCAAGTACAGTGATGAAGCTGTGAAGACTTTTA
AGGAGATCCGTGGATCACTGCATCCAGTCACTGCAATGCT
GGTGGCCAAGGATCTGAAAATCGATGGCTAGAACTCTGCC
TTCTTTCCTATTCTCCAGCATATCAGTCCTCGGACACATC
CACAACGCTTTTCTCTTCACTGGCCAAAGCTTGCCTTTTT
ATAATGTCTTGATGGAGGTTTCAGTCTCAGGAACAAAACC
ATTTCAGTATCATGTAGTTTAGTGCTGTAAAAAACCATCG
CATCTTAATCTGAAAGTTCCACTTTTGTCTGTTTATATAA
CATGTCAAAAGTACTGTTCTGTGCTAAACTCATCAATAAA
CTGTTTCTGCTCCTTTGTCCAATCAATAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations