Transcript

usp5-202

ID
ZDB-TSCRIPT-110325-1756
Name
usp5-202
Previous Names
  • usp5-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050929 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050929|OTTDARG00000009453|ZDB-GENE-040426-2584 usp5|OTTDARP00000039999 usp5-002 LG_ CU467865.7 Danio rerio protein_coding KNOWN, 3267 bp
AGCGCCCCTGGCCTCGAATGAACACACTGGATCATCAGCA
GCAGCTTTTCATTGAGGGGAATCGCAGAAACAAGGGGGCT
GTCAGAGACTTCAGGAGCGGGGGCCAAAGAAAACCCAGGC
GGGCAAGTGTGCGTAGGAAAGAAGGCAATTCCTGTTGAGG
CAGAGATGACGGAGGTTAGCGAGATATTGATGTCGGTTCT
GTCCGCGATTCGGGTTCCGAGGCCCGGGGATCGTGTTCAC
AAAGACGAGTGCGCTTTCTCCTTCTCCAGCCCGGAGAGTG
AGGGGGGCTTGTATGTCTGCATGAACAGCTTTCTCGGATT
TGGGAGTAAATACGTGGACCGACACCATGCCAAAACTGGT
CAGAGAGCTTACCTGCACATCACCCGGACCCGGAAAACAC
AGAAGGAGGATGATCCCAATTCAGGATCAGGTGATCCTCC
TAAAAAGAAGCCCACAAGACTGGCCATTGGTATTGAGGGA
GGGTTCGATGTTGAGCAGGAGCAGTATGAAGAAGAGGTCA
AGGTGGTTCTTTTCCCAGACCGACAGGAAGTGACACTGGA
TGATCTCTCCTCCATGCCAGATGTTGTTCGGGAGCGGGTG
TCTCTGTCAGTGGCGGAGCTTCAGGCAGCAGACTCAGTGT
CACACACTCTGCAGGTGCAGCAGTGGGACGGAGAAGTGCG
ACAGGAGTCAAAACATGCTGCTGAACTTAAACAACTCGAC
AATGGCCTCAAAATCCCGCCAAGTGGCTGGAAGTGTGAGG
TCTGTGAGCTGCAGGAGAACCTGTGGATGAATCTGACGGA
CGGGAAAGTTTTGTGTGGCCGGAGATATTTTGATGGCTCT
GGGGGGAATAACCATGCCCTCCTGTACTACCAGCAGACTG
GATACCCACTAGCTGTTAAACTCGGCACAATAACACCTGA
CGGAGCAGATGTCTATTCATATGATGAAGATGATATGGTA
TTAGATTCTAAGCTCCCAGAACACCTTTCCCATTTTGGCA
TTGATATGATGACTATGGAAAAGACGGAGAGAACCATGAC
TGAGCTGGAGATCGCAGTTAACCAGCGTGTGGGAGAGTGG
GAGGTCATCCAGGAGTCCGGCACCACTCTGAGGCCCCTGT
GGGGTCCGGGACTCACCGGCATGAAGAACCTGGGAAACAG
CTGCTACCTCAACTCTGTCATGCAAGTGCTCTTCACCATC
CCAGACTTCCAGACCAAATACGTTTCCAACATTGACAAGA
TCTTTGATGAGGCGCCCAGTGACCCTACCCAGGACTTTAA
GACTCAAGTAGCAAAGCTGGGCTATGGCCTTTTGTCAGGA
GAGTACTCTAAACCAGCCCCAGACCCCGCAGATGAACCTA
ACACCTCTGCTGAACCCAGGGGTGACCAGGTTGGTATTGC
ACCTCGCATGTTCAAAGCTCTGGTTGGACGAGGCCACCCT
GAGTTCTCCACCAATCGGCAACAGGATGCACAAGAGTTTC
TTCTTCACTTCATAAATATGGTGGAGAGGAATTGTCGGTC
AGGCATGAATCCTTCAGAAGCTTTCAGATTCTTGGTAGAG
GAGAAGATTGTATGCCAACAATCACAAAAAGCCAAGTATA
CCCAGCGAGTTGACTATATCGTCCAGCTGCCCGTTCCCAT
GGACCAGGCAACTAATATGGATGAGCTTCAAGAAGCAGAG
CGTCGTCGTGAGGAGGCGGAGTCATCTGGAGCTCCTCCCC
CTGTTGCACCTCGTGCTCAGATCCCATTTGCTGCCTGTCT
GGCTGCTCTCAGTGAACCGGAAACACTCACAGATTTCTGG
AGCTCTGCAGTTCAGGCCAAAACCACTGCCACAAAGACCA
CTCGCTTTGCTTCATTTCCTGATCATCTTGTCATCCAAAT
CAAGAAATTCACCTTTGGGTTGGATTGGGTTCCTAAAAAA
CTAGATGTGAGCATTGACGTTCCTGAAACGCTGGATCTGA
ATGCGCTCCGTGCTATGGGACAGCAGCCAGGGGAGGAGCT
TCTGCCCGAAGTGGCCCCGCCCCCGCTCATGACCCCCGAT
GTGGAGGTTAAAGCTCCAGTGTTGGACGACTCCACAGTGT
CTCAGCTGTGTGAGATGGGTTTTCCTCTGGAGGCCTGCAG
GAAGGCTGTGTATTACACAGGAAACACTGGCATTGATGCT
GCTATGAACTGGGTGATGGGACACATGGATGACCCTGATT
TCGCTGCACCTTTGGTGTTGCCTGGCTCTAGTTCTGCTCC
TGGCACGACACCCACAGAAAGCCTACCTGAAGAACACCTG
GCAACCATTGTTTCAATGGGATTCAGTCGAGATCAGGCTA
CTCGTGCTCTCAGAGCAACGAATAATGTTCTGGAGCGAGC
TGTGGACTGGATCTTCTCTCATCTGGATGATCTGGAGTCC
ATGGATGTGTCTGAAGGAGGACGCTCAGAGGGTGGAAGTG
AGGCCAGTCGAGAGCCTCCTCCAGGACCTCGTGTCCGTGA
TGGAACTGGAAAGTATGAGCTCTTTGCATTCATCAGTCAC
ATGGGATCGAGCACAATGTGTGGTCATTACGTCTGCCACA
TCAAGAAGGACCAACAGTGGGTCATTTTTAACGATCAGAA
AGTTTGTGCCTCTGAGAAACCACCGAAGGACCTGGGATAC
CTGTACTTTTACAGGAGAGTGGTGGAATAAACTAGAAAAT
CATCTCTGTCTGTCTCATGCACGCACACATACACATACAC
ATGCACACACACAGTTCTGTTTCTGGTCTAAAGGTATAGT
TGGCTCCTGCTTCTGAAATGATCCGCAGTTTAAGTCAAAG
CACTTCTCCATCTGATATATTCACTATTGAGAGACAGCTC
ACACAGGGGAAGGAAAAAAAAATCAAATGTAGGATGTGCG
GGTTAGAGTGTTCTTACTCAAAACGCCCATGCTGTGCAGC
GCCTTACCACACACACACACACACAAACACAAGACAGTAG
TCTCCTTCGTGCCTCCCCCTGATTGGATAGTGGCTTTTGT
GACATCACCGCTTCTAGAGCTAAGCTCCACCTTCCTTTAT
GTGTTCCAGAATGTTTCTGCAAATGTTTAATGGCAAGTAA
ATATCACTAAATCACACTCAAATAACTGCTAAATATTATG
TATTGGAGTTTTAAATTTAAAATAATAATAAATGCAAAAG
GTATCGTGCGGTTTCACTTTCCTTATGTTTTGTTCTCCTT
TTTTGGGGGGAGGAAAGAATCATTTTGTTCATTTTGCTTT
AAAATAAAAAAACGTGTCTCTTTGCTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations